| MirGeneDB ID | Ami-Mir-187 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-187 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | American alligator (Alligator mississippiensis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | ami-mir-187 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-187 Bta-Mir-187 Cfa-Mir-187 Cja-Mir-187 Cli-Mir-187 Cpi-Mir-187 Cpo-Mir-187 Dno-Mir-187 Dre-Mir-187 Eca-Mir-187 Ete-Mir-187 Gga-Mir-187 Gja-Mir-187 Gmo-Mir-187 Hsa-Mir-187 Laf-Mir-187 Lch-Mir-187 Loc-Mir-187 Mal-Mir-187 Mdo-Mir-187 Mml-Mir-187 Mmr-Mir-187 Mmu-Mir-187 Mun-Mir-187 Neu-Mir-187 Oan-Mir-187 Ocu-Mir-187 Pab-Mir-187 Rno-Mir-187 Sha-Mir-187 Spt-Mir-187 Tgu-Mir-187 Tni-Mir-187 Xtr-Mir-187 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Osteichthyes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Osteichthyes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_000281125.3_ASM28112v4_AMI_add) |
NW_017714011.1: 1380499-1380556 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CGUGUCU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GGAUUUUGUCUAACAUAUUGUGAGACCUCCGGCUACAACACAGGACAUGGGAGCUUUUCUGAACCCUCGUGUCUUGUGUUGCAGCCAGAGGGGCACAUCCUUUCAGCAGAGUCCAAGGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GGAUUUUGUCUAACAUAU---| AGA C A AGCUUU UGUG CCUC GGCU CAACACAGGACAUGGG U ACAC GGAG CCGA GUUGUGUUCUGUGCUC C GGAACCUGAGACGACUUUCCU^ GG- A C CCAAGU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Drosha cut +1 on the 5p arm. The 3' end of the 3p arm is also likely monoadenylated when not monouridylated despite the templated adenosine. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ami-Mir-187_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038200 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGCUACAACACAGGACAUGGGA -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ami-Mir-187_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038201 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
36- UCGUGUCUUGUGUUGCAGCCAG -58
Get sequence
|






