| MirGeneDB ID | Dno-Mir-218-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-218 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Nine-banded armadillo (Dasypus novemcinctus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | dno-mir-218-1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Dno-Mir-218-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-218-P2 Ami-Mir-218-P2 Bta-Mir-218-P2 Cfa-Mir-218-P2 Cja-Mir-218-P2 Cli-Mir-218-P2 Cmi-Mir-218-P2 Cpi-Mir-218-P2 Cpo-Mir-218-P2 Dre-Mir-218-P2 Eca-Mir-218-P2 Ete-Mir-218-P2 Gga-Mir-218-P2 Gja-Mir-218-P2 Gmo-Mir-218-P2 Hsa-Mir-218-P2 Laf-Mir-218-P2 Lch-Mir-218-P2 Loc-Mir-218-P2 Mal-Mir-218-P2 Mdo-Mir-218-P2 Mml-Mir-218-P2 Mmr-Mir-218-P2 Mmu-Mir-218-P2 Mun-Mir-218-P2 Neu-Mir-218-P2 Oan-Mir-218-P2 Ocu-Mir-218-P2 Pab-Mir-218-P2 Pbv-Mir-218-P2 Pma-Mir-218-o2 Rno-Mir-218-P2 Sha-Mir-218-P2 Spt-Mir-218-P2 Sto-Mir-218-P2 Tgu-Mir-218-P2 Tni-Mir-218-P2 Xla-Mir-218-P2a Xla-Mir-218-P2b Xtr-Mir-218-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (dasNov3) |
JH581835: 1866685-1866748 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UGUGCUU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GGUGUAGUGAUUAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCCAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACAGCAUGGCAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GGUGUAGUGAUUAUGUA--| A U U CU GGUUGCCAG GCG GAU UUCUGU GUGCUUGAU AACCAUGU G CGC CUG AAGGUA CACGAACUG UUGGUACA U ACGGUACGACAUCUUUCGA^ A C C CC AAAUGAGUA 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There are Dicer cuts ranging from +1 to +4 on both arms but this represents the highest mature form across most vertebrates. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Dno-Mir-218-P2_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0047768 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UUGUGCUUGAUCUAACCAUGU -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Dno-Mir-218-P2_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0047769 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
43- AUGGUUCCGUCAAGCACCAUG -64
Get sequence
|






