| MirGeneDB ID | Ete-Mir-208-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-208 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Lesser hedgehog tenrec (Echinops telfairi) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ete-Mir-208-P1a Ete-Mir-208-P1b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-208-P2 Ami-Mir-208-P2 Bta-Mir-208-P2 Cfa-Mir-208-P2 Cja-Mir-208-P2 Cpi-Mir-208-P2 Cpo-Mir-208-P2 Dno-Mir-208-P2 Eca-Mir-208-P2 Gja-Mir-208-P2 Hsa-Mir-208-P2 Laf-Mir-208-P2 Lch-Mir-208-P2 Mdo-Mir-208-P2 Mml-Mir-208-P2 Mmu-Mir-208-P2 Oan-Mir-208-P2 Ocu-Mir-208-P2 Pab-Mir-208-P2 Pbv-Mir-208-P2 Rno-Mir-208-P2 Sha-Mir-208-P2 Spt-Mir-208-P2 Xla-Mir-208-P2a Xla-Mir-208-P2b Xtr-Mir-208-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (echTel2) |
manual_Ete-Mir-208-P1: 65-121 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UAAGACG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GUUGCACCUGACCCACUUCCUGUGACAGGCGAGCUUUUGGCCCGGGUUAUACCUGACGCUCACGUAUAAGACGAGCAAAAAGCUUGUUGGUCAGAGGAGCUACCGUCGAUCAGCCUGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GUUGCACCUGACCCACU--| G AG G C GG CUGAC UCCU UGAC GCGAGCUUUU GC CG UUAUAC \ AGGA ACUG UGUUCGAAAA CG GC AAUAUG G GUCCGACUAGCUGCCAUCG^ G GU A A AG CACUC 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | Not in assembly but in trace archive. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ete-Mir-208-P2_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GAGCUUUUGGCCCGGGUUAUAC -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ete-Mir-208-P2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- AUAAGACGAGCAAAAAGCUUGU -57
Get sequence
|






