| MirGeneDB ID | Lgi-Mir-1993 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-1993 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Owl limpet (Lottia gigantea) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | lgi-mir-1993 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Agr-Mir-1993 Ava-Mir-1993-P10 Ava-Mir-1993-P11 Bko-Mir-1993 Bpl-Mir-1993 Cbr-Mir-1993 Cel-Mir-1993 Csc-Mir-1993 Cte-Mir-1993 Dgr-Mir-1993 Dma-Mir-1993 Dpu-Mir-1993 Eba-Mir-1993 Efe-Mir-1993-P1 Efe-Mir-1993-P2 Egr-Mir-1993 Esc-Mir-1993 Gsa-Mir-1993 Gsp-Mir-1993 Hru-Mir-1993 Isc-Mir-1993 Lan-Mir-1993 Llo-Mir-1993 Lpo-Mir-1993-P3 Lpo-Mir-1993-P4 Lpo-Mir-1993-P5 Mgi-Mir-1993 Mom-Mir-1993 Npo-Mir-1993 Obi-Mir-1993 Ofu-Mir-1993-P12 Ofu-Mir-1993-P13 Ovu-Mir-1993 Pau-Mir-1993 Pca-Mir-1993 Pcr-Mir-1993-P14 Pcr-Mir-1993-P15 Pdu-Mir-1993 Pve-Mir-1993-P8 Pve-Mir-1993-P9 Rph-Mir-1993 Sma-Mir-1993 Sme-Mir-1993-P6 Sme-Mir-1993-P7 Snu-Mir-1993 Tur-Mir-1993 War-Mir-1993 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Lotgi1) |
LOTGIsca_1: 2120424-2120483 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUAUGC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GUACUAUUGAAGUCAAAGUCUGAGUAUAUUUCGGGAAUAUAGGCAUAAUGCCCGUUAAUACUUGAACGUAUUAUGCUGAUAUUCACGAGAUCCGCUGGACAGAAUCAACAUUCAUUGGGAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GUACUAUUGAAGUCAAA---| G AU G A CCGUUAA GUCU AGU AUUUCG GAAUAU GGCAUAAUGC U CAGG UCG UAGAGC CUUAUA UCGUAUUAUG A AGGGUUACUUACAACUAAGA^ - CC A G CAAGUUC . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Lgi-Mir-1993_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UCGGGAAUAUAGGCAUAAUGCC -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Lgi-Mir-1993_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0009723 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UAUUAUGCUGAUAUUCACGAGA -60
Get sequence
|






