| MirGeneDB ID | Mun-Mir-103-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-103 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Microcaecilia (Microcaecilia unicolor) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Mun-Mir-103-P2 Mun-Mir-103-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-103-P1 Ami-Mir-103-P1 Bta-Mir-103-P1 Cfa-Mir-103-P1 Cja-Mir-103-P1 Cli-Mir-103-P1 Cmi-Mir-103-P1 Cpi-Mir-103-P1 Cpo-Mir-103-P1 Dno-Mir-103-P1 Dre-Mir-103-P1a Dre-Mir-103-P1b Eca-Mir-103-P1 Ete-Mir-103-P1 Gga-Mir-103-P1 Gja-Mir-103-P1 Hmi-Mir-103 Hsa-Mir-103-P1 Laf-Mir-103-P1 Lch-Mir-103-P1 Loc-Mir-103-P1 Mal-Mir-103-P1a Mdo-Mir-103-P1 Mml-Mir-103-P1 Mmr-Mir-103-P1 Mmu-Mir-103-P1 Oan-Mir-103-P1 Ocu-Mir-103-P1 Pab-Mir-103-P1 Pbv-Mir-103-P1 Pfl-Mir-103 Pma-Mir-103-o1 Pmi-Mir-103 Rno-Mir-103-P1 Sha-Mir-103-P1 Sko-Mir-103 Spt-Mir-103-P1 Spu-Mir-103 Sro-Mir-103 Sto-Mir-103-P1 Tgu-Mir-103-P1 Tni-Mir-103-P1a Xbo-Mir-103 Xla-Mir-103-P1c Xla-Mir-103-P1d Xtr-Mir-103-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_901765095.2_aMicUni1.2) |
LR594639.1: 131108930-131108989 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GCAGCAU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUGCUAUAUGCGAGAAACCUCAGUUCCUUUGGCUUCUUUACAGUGCUGCCUUGUCGCAUAUGGAUCAAGCAGCAUUGUACAGGGCUAUGAAGGCACCGAGAAUAUACAACUGAAUUAUUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AUGCUAUAUGCGAGAAAC-- A U --| U U C UCGCA CUC GU CCUUU GGCU CU UACAGUGCUGC UUG U GAG CA GGAAG UCGG GA AUGUUACGACG AAC A CUUAUUAAGUCAACAUAUAA C C UA^ - C - UAGGU . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Mun-Mir-103-P1_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGCUUCUUUACAGUGCUGCCUUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Mun-Mir-103-P1_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- AGCAGCAUUGUACAGGGCUAUGA -60
Get sequence
|






