| MirGeneDB ID | Ocu-Mir-146-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-146 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Rabbit (Oryctolagus cuniculus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | ocu-mir-146b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ocu-Mir-146-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-146-P1 Ami-Mir-146-P1 Bta-Mir-146-P1 Cfa-Mir-146-P1 Cja-Mir-146-P1 Cli-Mir-146-P1 Cmi-Mir-146-P1 Cpi-Mir-146-P1 Cpo-Mir-146-P1 Dno-Mir-146-P1 Dre-Mir-146-P1 Ebu-Mir-146 Eca-Mir-146-P1 Ete-Mir-146-P1 Gga-Mir-146-P1 Gja-Mir-146-P1 Gmo-Mir-146-P1 Hsa-Mir-146-P1 Laf-Mir-146-P1 Lch-Mir-146-P1 Loc-Mir-146-P1 Mal-Mir-146-P1 Mdo-Mir-146-P1 Mml-Mir-146-P1 Mmr-Mir-146-P1 Mmu-Mir-146-P1 Mun-Mir-146-P1 Oan-Mir-146-P1 Pab-Mir-146-P1 Pbv-Mir-146-P1 Pma-Mir-146 Rno-Mir-146-P1 Sha-Mir-146-P1 Spt-Mir-146-P1 Tgu-Mir-146-P1 Tni-Mir-146-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (oryCun2_add) |
chr18: 50441898-50441957 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GAGAACU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AAAGGUGCAAGGACUUUGGCCACCUGGCUCUGAGAACUGAAUUCCAUAGGCCGUGAGCUCUAGCAAAUGCCCUGGGGACUCAGUUCUGGUGCCCGGCUGUGCUGCACCAUCUGUGCCAAGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AAAGGUGCAAGGACUUUG - -| U U G A A C GAGCU GC CA CC GGC CU AGAACUGA UUCC UAGG CGU C CG GU GG CCG GG UCUUGACU AGGG GUCC GUA U GAACCGUGUCUACCACGU U C^ C U - C - C AACGA . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ocu-Mir-146-P1_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0048255 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGAGAACUGAAUUCCAUAGGCCGU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ocu-Mir-146-P1_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0048256 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- GCCCUGGGGACUCAGUUCUGGU -60
Get sequence
|






