| MirGeneDB ID | Sto-Mir-205-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-205 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Sto-Mir-205-P1 Sto-Mir-205-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-205-P4 Ami-Mir-205-P4 Bta-Mir-205-P4 Cfa-Mir-205-P4 Cja-Mir-205-P4 Cli-Mir-205-P4 Cmi-Mir-205-P4 Cpi-Mir-205-P4 Cpo-Mir-205-P4 Dno-Mir-205-P4 Dre-Mir-205-P4a Eca-Mir-205-P4 Ete-Mir-205-P4 Gga-Mir-205-P4 Gja-Mir-205-P4 Gmo-Mir-205-P4a Gmo-Mir-205-P4b Hsa-Mir-205-P4 Laf-Mir-205-P4 Lch-Mir-205-P4 Loc-Mir-205-P4 Loc-Mir-205-P4-as Mal-Mir-205-P4a Mal-Mir-205-P4b Mdo-Mir-205-P4 Mml-Mir-205-P4 Mmr-Mir-205-P4 Mmu-Mir-205-P4 Mun-Mir-205-P4 Neu-Mir-205-P4 Oan-Mir-205-P4 Ocu-Mir-205-P4 Pab-Mir-205-P4 Pbv-Mir-205-P4 Rno-Mir-205-P4 Sha-Mir-205-P4 Spt-Mir-205-P4 Tgu-Mir-205-P4 Tni-Mir-205-P4a Xla-Mir-205-P4c Xla-Mir-205-P4d Xtr-Mir-205-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01000299.1: 865493-865551 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CCUUCAU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CCUUAAUGACAUAAUCCAUGCAUUCUGCUGUCCUUCAUUCCACCGGAGUCUGUAACAUAACCAAUCAGAUUUCAGUGGUGUGAAGUGCAGGAGACAUGGAACACAAUCUUCCAAUCAACGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CCUUAAUGACAUAAUCCAUG- -| G UC U C UAACAU CAU UCU CUG CUUCAU CCAC GGAGUCUG \ GUA AGA GAC GAAGUG GGUG CUUUAGAC A CAACUAACCUUCUAACACAAG C^ G GU U A UAACCA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Dicer cut +1 on the 5p arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-205-P4_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-205-P4_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- GAUUUCAGUGGUGUGAAGUGCA -59
Get sequence
|






