| MirGeneDB ID | Aae-Mir-9-P10b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-9 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Yellow fever mosquito (Aedes aegypti) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | aae-mir-9a-1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Aae-Mir-9-P10a Aae-Mir-9-P11 Aae-Mir-9-P12-v1 Aae-Mir-9-P13 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aga-Mir-9-P10 Agr-Mir-9 Bfl-Mir-9 Bge-Mir-9-P10 Bko-Mir-9 Bla-Mir-9 Bpl-Mir-9 Cin-Mir-9 Cte-Mir-9 Dan-Mir-9-P10 Dgr-Mir-9 Dlo-Mir-9-P10 Dma-Mir-9-P10 Dme-Mir-9-P10 Dmo-Mir-9-P10 Dpu-Mir-9-P10 Dsi-Mir-9-P10 Dya-Mir-9-P10 Eba-Mir-9 Egr-Mir-9 Esc-Mir-9 Gpa-Mir-9-P10 Gsa-Mir-9 Gsp-Mir-9 Hme-Mir-9-P10 Hmi-Mir-9 Hru-Mir-9 Isc-Mir-9 Lan-Mir-9 Lgi-Mir-9 Llo-Mir-9 Mom-Mir-9 Npo-Mir-9 Obi-Mir-9 Ofu-Mir-9 Ovu-Mir-9 Pau-Mir-9 Pdu-Mir-9 Pmi-Mir-9 Pve-Mir-9 Rph-Mir-9 Sma-Mir-9 Snu-Mir-9 Spu-Mir-9 Tca-Mir-9-P10 War-Mir-9 Xbo-Mir-9 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | A. aegypti | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Aaeg_L3) |
supercont1.517: 555117-555178 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-9-P10b) |
Mir-9-P10b
supercont1.517: 555117-555178 [+]
Ensembl
Mir-9-P10a supercont1.517: 574919-574980 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CUUUGGU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UACUUACUUACCCAAUCGGUGUCAAAGUUCUCUUUGGUUAUCUAGCUGUAUGAGUGAAUUUAGAACAUCAUAAAGCUAGCAUACCGAAGUUAAUAGUUGACUACCAAUCAGCGUUGGAUGGUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 UACUUACUUACCCAAUCG - A-| CU UAU G GUGAAU GU GUCAA GUU CUUUGGU CUAGCU UAUGA U CA CAGUU UAA GAAGCCA GAUCGA AUACU U UGGUAGGUUGCGACUAAC U GA^ UU UAC A ACAAGA 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Dicer cut -1 on both arms. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Aae-Mir-9-P10b_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0014323 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Aae-Mir-9-P10b_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
39- AUAAAGCUAGCAUACCGAAGUUA -62
Get sequence
|






