| MirGeneDB ID | Ami-Mir-216-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-216 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | American alligator (Alligator mississippiensis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | ami-mir-216b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ami-Mir-216-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-216-P2 Aca-Mir-216-P2a Aga-Mir-216-P2 Asu-Mir-216-P2 Ava-Mir-216-P2 Bfl-Mir-216-P2 Bge-Mir-216-P2 Bko-Mir-216-P2 Bla-Mir-216-P2 Bpl-Mir-216-P2 Bta-Mir-216-P2a Cbr-Mir-216-P2 Cel-Mir-216-P2 Cfa-Mir-216-P2a Cja-Mir-216-P2a Cli-Mir-216-P2a Cmi-Mir-216-P2a Cpi-Mir-216-P2a Cpo-Mir-216-P2a Csc-Mir-216-P2 Dan-Mir-216-P2 Dlo-Mir-216-P2 Dma-Mir-216-P2 Dme-Mir-216-P2 Dmo-Mir-216-P2 Dno-Mir-216-P2a Dpu-Mir-216-P2 Dre-Mir-216-P2a Dsi-Mir-216-P2 Dya-Mir-216-P2 Ebu-Mir-216-P2a2 Eca-Mir-216-P2a Ete-Mir-216-P2a Gga-Mir-216-P2a Gja-Mir-216-P2a Gmo-Mir-216-P2a Hme-Mir-216-P2 Hsa-Mir-216-P2a Isc-Mir-216-P2 Laf-Mir-216-P2a Lch-Mir-216-P2a Loc-Mir-216-P2a Mal-Mir-216-P2a Mdo-Mir-216-P2a Mml-Mir-216-P2a Mmr-Mir-216-P2a Mmu-Mir-216-P2a Neu-Mir-216-P2a Oan-Mir-216-P2a Ocu-Mir-216-P2a Pab-Mir-216-P2a Pbv-Mir-216-P2a Pca-Mir-216-P2 Pma-Mir-216-P2a1 Pma-Mir-216-P2a2 Rno-Mir-216-P2a Sha-Mir-216-P2a Spt-Mir-216-P2a Sto-Mir-216-P2a Tca-Mir-216-P2 Tgu-Mir-216-P2a Tni-Mir-216-P2a Tur-Mir-216-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Nephrozoa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_000281125.3_ASM28112v4_AMI_add) |
NW_017713592.1: 3406274-3406335 [-] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-216-P2a) |
Mir-217-v2
NW_017713592.1: 3391408-3391468 [-]
UCSC
Mir-217-v1 NW_017713592.1: 3391409-3391467 [-] UCSC Mir-216-P2b NW_017713592.1: 3395052-3395113 [-] UCSC Mir-216-P2a NW_017713592.1: 3406274-3406335 [-] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAUCUCU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AACCCUCCUGGAUACAAGUCGCAGACUGGGAAAUCUCUACAGGCAAAUGUGAUGUCUUUAUAGUAAUCUCACAAUUACCUAUAGAGAUUCUUCAAUCUGGCAUCUUCAUACACAGUUAACUAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AACCCUCCUGGAUACAAGUC- -| C GA C C A UGUCUUU G CAGA UGG AAUCUCUA AGG AA UGUGA A C GUCU ACU UUAGAGAU UCC UU ACACU U AUCAAUUGACACAUACUUCUA G^ A UC A A A CUAAUGA 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a set of reads -3 on the 3p arm but there is no corresponding 5p read. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ami-Mir-216-P2a_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038243 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AAAUCUCUACAGGCAAAUGUGA -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ami-Mir-216-P2a_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038244 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- ACAAUUACCUAUAGAGAUUCUU -62
Get sequence
|






