| MirGeneDB ID | Cpo-Mir-24-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-24 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Guinea pig (Cavia porcellus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cpo-mir-24-1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cpo-Mir-24-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-24-P2 Ami-Mir-24-P2 Bta-Mir-24-P2 Cfa-Mir-24-P2 Cja-Mir-24-P2 Cmi-Mir-24-P2 Cpi-Mir-24-P2 Dno-Mir-24-P2 Dre-Mir-24-P2a Dre-Mir-24-P2b Eca-Mir-24-P2 Ete-Mir-24-P2 Gga-Mir-24-P2 Gmo-Mir-24-P2b Hsa-Mir-24-P2 Laf-Mir-24-P2 Lch-Mir-24-P2 Loc-Mir-24-P2 Mdo-Mir-24-P2 Mml-Mir-24-P2 Mmr-Mir-24-P2 Mmu-Mir-24-P2 Mun-Mir-24-P2 Neu-Mir-24-P2 Oan-Mir-24-P2 Ocu-Mir-24-P2 Pab-Mir-24-P2 Pbv-Mir-24-P2 Rno-Mir-24-P2 Sha-Mir-24-P2 Spt-Mir-24-P2 Sto-Mir-24-P2 Tgu-Mir-24-P2 Tni-Mir-24-P2b Xla-Mir-24-P2c Xla-Mir-24-P2d Xtr-Mir-24-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (cavPor3) |
scaffold_42: 4055099-4055157 [-] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-24-P2) |
Mir-24-P2
scaffold_42: 4055099-4055157 [-]
UCSC
Mir-27-P2 scaffold_42: 4055574-4055636 [-] UCSC Mir-23-P2 scaffold_42: 4055809-4055868 [-] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GGCUCAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UGCUCCGGCUGUCGUUGGACCCGCCCUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCUUGUACACACUGGCUCAGUUCAGCAGGAACAGGAGUCGAGCCCUUGAGCAAAGCCUCCCGUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UGCUCCGGCUGUCGUUGGACC---| CC G G A UA UCUCU CG CUCC GU CCU CUGAGCUGA UCAGU U GC GAGG CA GGA GACUUGACU GGUCA G CUGCCCUCCGAAACGAGUUCCCGA^ U- A A C C- CACAU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | Although not well supported by deep read data all taxa sequenced in this study show the same read pattern and better and DcRNAe deeply sequenced vertebrate taxa are all clearly Group 2 miRNAs suggesting that this too is likely a Group 2 miRNA. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cpo-Mir-24-P2_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0046880 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GUGCCUACUGAGCUGAUAUCAGU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cpo-Mir-24-P2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0046881 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- UGGCUCAGUUCAGCAGGAACAG -59
Get sequence
|






