| MirGeneDB ID | Cte-Mir-2-o16 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Polychaete worm (Capitella teleta) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cte-mir-2d-1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cte-Mir-2-o13 Cte-Mir-2-o14 Cte-Mir-2-o15 Cte-Mir-2-o17 Cte-Mir-2-o18 Cte-Mir-2-o19 Cte-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | C. teleta | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Capitella_teleta_v1.0) |
CAPTEscaffold_876: 29247-29305 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o16) |
Mir-2-o18
CAPTEscaffold_876: 28955-29017 [-]
Ensembl
Mir-2-o17 CAPTEscaffold_876: 29085-29145 [-] Ensembl Mir-2-o16 CAPTEscaffold_876: 29247-29305 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UCUUCCUCACCCUCAUUGAGAACCUGCACUUGAUCAAGGUGGCUGUGUCUUGUGUCCACUGCUUCAAAUCACAGCCUGCUUUGGUCAUUUGCUGGUUUUUCAUCACCUUGUGAAAUGUUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UCUUCCUCACCCUCAUU-- U CU -| UC UGUCC GAGAACC GCA UGAUCAAGGU GGCUGUG UUG A UUUUUGG CGU ACUGGUUUCG CCGACAC AAC C UUGUAAAGUGUUCCACUAC U UU U^ UA UUCGU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cte-Mir-2-o16_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGAUCAAGGUGGCUGUGUCUUGU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cte-Mir-2-o16_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0009678 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
36- AAUCACAGCCUGCUUUGGUCAUU -59
Get sequence
|






