| MirGeneDB ID | Dpu-Mir-96-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-96 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Common water flea (Daphnia pulex) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | dpu-mir-263b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Dpu-Mir-96-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-96-P2 Aca-Mir-96-P2 Aga-Mir-96-P2 Agr-Mir-96-P2 Ami-Mir-96-P2 Asu-Mir-96-P2 Ava-Mir-96-o2 Bfl-Mir-96-P2f Bfl-Mir-96-P2g Bfl-Mir-96-P2h Bfl-Mir-96-P2i Bfl-Mir-96-P2j Bfl-Mir-96-P2k Bge-Mir-96-P2 Bla-Mir-96-P2f Bla-Mir-96-P2g Bla-Mir-96-P2h Bla-Mir-96-P2i Bla-Mir-96-P2j Bla-Mir-96-P2k Bta-Mir-96-P2 Cbr-Mir-96-P2p Cbr-Mir-96-P2q Cel-Mir-96-P2 Cfa-Mir-96-P2 Cin-Mir-96-P2 Cja-Mir-96-P2 Cli-Mir-96-P2 Cmi-Mir-96-P2 Cpi-Mir-96-P2 Cpo-Mir-96-P2 Csc-Mir-96-P2w Cte-Mir-96-P2 Dan-Mir-96-P2 Dlo-Mir-96-P2 Dma-Mir-96-P2-v1 Dme-Mir-96-P2 Dno-Mir-96-P2 Dre-Mir-96-P2a Dsi-Mir-96-P2 Dya-Mir-96-P2 Eba-Mir-96-P2 Ebu-Mir-96-P2e Eca-Mir-96-P2 Efe-Mir-96-P2n Efe-Mir-96-P2o Ete-Mir-96-P2 Gga-Mir-96-P2 Gja-Mir-96-P2 Gmo-Mir-96-P2a Gpa-Mir-96-P2 Hme-Mir-96-P2 Hru-Mir-96-P2 Hsa-Mir-96-P2 Isc-Mir-96-P2 Laf-Mir-96-P2 Lan-Mir-96-P2 Lch-Mir-96-P2 Lgi-Mir-96-P2 Lhy-Mir-96-P2 Llo-Mir-96-P2-v1 Loc-Mir-96-P2 Lpo-Mir-96-P2r Lpo-Mir-96-P2s-v1 Lpo-Mir-96-P2t-v1 Lpo-Mir-96-P2u Lpo-Mir-96-P2v-v1 Mal-Mir-96-P2a Mal-Mir-96-P2b Mdo-Mir-96-P2 Mgi-Mir-96-P2l Mgi-Mir-96-P2m Mml-Mir-96-P2 Mmr-Mir-96-P2 Mmu-Mir-96-P2 Mom-Mir-96-P2x Mom-Mir-96-P2y Mom-Mir-96-P2z Mun-Mir-96-P2 Neu-Mir-96-P2 Npo-Mir-96-P2 Oan-Mir-96-P2 Obi-Mir-96-P2 Ocu-Mir-96-P2 Ofu-Mir-96-P2 Ovu-Mir-96-P2 Pab-Mir-96-P2 Pau-Mir-96-P2 Pbv-Mir-96-P2 Pca-Mir-96-P2 Pdu-Mir-96-P2 Pfl-Mir-96-P2 Pma-Mir-96-P2o1 Pmi-Mir-96-P2 Pve-Mir-96-P2 Rno-Mir-96-P2 Rph-Mir-96-P2 Sha-Mir-96-P2 Sko-Mir-96-P2 Snu-Mir-96-P2 Spt-Mir-96-P2 Spu-Mir-96-P2 Sto-Mir-96-P2 Tca-Mir-96-P2 Tgu-Mir-96-P2 Tni-Mir-96-P2a Tni-Mir-96-P2b Tur-Mir-96-P2 War-Mir-96-P2 Xla-Mir-96-P2c Xla-Mir-96-P2d Xtr-Mir-96-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Daphnia_pulex.V1.0) |
DAPPUscaffold_87: 475817-475879 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-96-P2-v1) |
Mir-96-P3
DAPPUscaffold_87: 475620-475711 [+]
Ensembl
Mir-96-P2-v1 DAPPUscaffold_87: 475817-475879 [+] Ensembl Mir-96-P2-v2 DAPPUscaffold_87: 475818-475878 [+] Ensembl Novel-3 DAPPUscaffold_87: 490784-490839 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Variant | Dpu-Mir-96-P2-v1 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UUGGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUAUGUAGGAAAUUAAAUAUUCCGGUGAUCCUUGGCACUGGAAGAAUUCACAGAGUGCAUUACGACAGGUCGUGGGUUCCCUGGUGCCAGAGAUUGCUCCCGGAAAUCAAUAUCAUCACAAUUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AUAUGUAGGAAAUUAAAUA ---|UG C UG AA AGAGUGCAU UUCCG G AUC UUGGCAC G GAAUUCAC U AAGGC C UAG GACCGUG C CUUGGGUG A UUAACACUACUAUAACUA- CCU^GU A GU C- CUGGACAGC 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Dpu-Mir-96-P2-v1_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0012650 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CUUGGCACUGGAAGAAUUCACAGA -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Dpu-Mir-96-P2-v1_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
41- GUGGGUUCCCUGGUGCCAGAGA -63
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Variant | Dpu-Mir-96-P2-v2 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UGGCACU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UAUGUAGGAAAUUAAAUAUUCCGGUGAUCCUUGGCACUGGAAGAAUUCACAGAGUGCAUUACGACAGGUCGUGGGUUCCCUGGUGCCAGAGAUUGCUCCCGGAAAUCAAUAUCAUCACAAUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 UAUGUAGGAAAUUAAAUAU ---|UG C UG AA AGAGUGCAU UCCG G AUC UUGGCAC G GAAUUCAC U AGGC C UAG GACCGUG C CUUGGGUG A UAACACUACUAUAACUAA- CCU^GU A GU C- CUGGACAGC . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Dpu-Mir-96-P2-v2_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0012650 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UUGGCACUGGAAGAAUUCACAGA -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Dpu-Mir-96-P2-v2_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- GUGGGUUCCCUGGUGCCAGAG -61
Get sequence
|






