| MirGeneDB ID | Ete-Mir-148-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-148 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Lesser hedgehog tenrec (Echinops telfairi) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ete-Mir-148-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-148-P4 Ami-Mir-148-P4 Bta-Mir-148-P4 Cfa-Mir-148-P4 Cja-Mir-148-P4 Cli-Mir-148-P4 Cmi-Mir-148-P4 Cpi-Mir-148-P4 Cpo-Mir-148-P4 Dno-Mir-148-P4 Ebu-Mir-148 Eca-Mir-148-P4 Gga-Mir-148-P4 Gja-Mir-148-P4 Hsa-Mir-148-P4 Laf-Mir-148-P4 Lch-Mir-148-P4 Loc-Mir-148-P4 Mml-Mir-148-P4 Mmr-Mir-148-P4 Mmu-Mir-148-P4 Mun-Mir-148-P4 Neu-Mir-148-P4 Ocu-Mir-148-P4 Pab-Mir-148-P4 Pbv-Mir-148-P4 Rno-Mir-148-P4 Sha-Mir-148-P4 Spt-Mir-148-P4 Tgu-Mir-148-P4 Xla-Mir-148-P4a Xla-Mir-148-P4b Xtr-Mir-148-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (echTel2) |
JH980427: 1097293-1097353 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CAGUGCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUUCCAGGCACUACCGUUAGCCUUUGAGGUGAAGUUCUGUCAUACACUCAGGCUGUGGCUCUGUGAAAGUCAGUGCAUCACAGAACUUUGUCUCGAAAGCUUUCUAGCAACUACCCUUUUGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AUUCCAGGCACUACCGUU--| C UG C A CA GUGGCU AGC UUUGAGG AAGUUCUGU AU CACU GGCU \ UCG AAGCUCU UUCAAGACA UA GUGA CUGA C GUUUUCCCAUCAACGAUCUU^ A GU C C -- AAGUGU . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ete-Mir-148-P4_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GAAGUUCUGUCAUACACUCAGGCU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ete-Mir-148-P4_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
39- UCAGUGCAUCACAGAACUUUGU -61
Get sequence
|






