| MirGeneDB ID | Gja-Mir-221-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-221 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Schlegels Japanese gecko (Gekko japonicus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Gja-Mir-221-P1a Gja-Mir-221-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-221-P2a Ami-Mir-221-P2a Bta-Mir-221-P2a Cfa-Mir-221-P2a Cja-Mir-221-P2a Cli-Mir-221-P2a Cmi-Mir-221-P2a Cpi-Mir-221-P2a Cpo-Mir-221-P2a Dno-Mir-221-P2a Dre-Mir-221-P2a1 Dre-Mir-221-P2a2 Eca-Mir-221-P2a Ete-Mir-221-P2a Gga-Mir-221-P2a Gmo-Mir-221-P2a1 Gmo-Mir-221-P2a2 Hsa-Mir-221-P2a Laf-Mir-221-P2a Lch-Mir-221-P2a Loc-Mir-221-P2a Mal-Mir-221-P2a1 Mal-Mir-221-P2a2 Mdo-Mir-221-P2a Mml-Mir-221-P2a Mmr-Mir-221-P2a Mmu-Mir-221-P2a Mun-Mir-221-P2a Neu-Mir-221-P2a Oan-Mir-221-P2a Ocu-Mir-221-P2a Pab-Mir-221-P2a Pbv-Mir-221-P2a Rno-Mir-221-P2a Sha-Mir-221-P2a Spt-Mir-221-P2a Sto-Mir-221-P2a Tgu-Mir-221-P2a Tni-Mir-221-P2a1 Xla-Mir-221-P2a3 Xla-Mir-221-P2a4 Xtr-Mir-221-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_001447785.1_Gekko_japonicus) |
NW_015165234.1: 1526266-1526328 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-221-P2a) |
Mir-221-P1a
NW_015165234.1: 1525899-1525961 [+]
Mir-221-P2a NW_015165234.1: 1526266-1526328 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GCUACAU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GAAGAAAUAUGAUCUGGCCUUGGGGCAUGAACCUGGCAUACAAUGUAGAAUUCUGUGUUUGUUAAGCAACAGCUACAUUGUCUGCUGGGUUUCAGGCUGCCUGGAAAUACAAAGAAAAUUUCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GAAGAAAUAUGAUCUGG-- UU - A -| UG U AAUUCUGUGUU CC GG GGC UG AACC GCA ACAAUGUAG U GG CC UCG AC UUGG CGU UGUUACAUC G UCUUUAAAAGAAACAUAAA U- G G U^ GU C GACAACGAAUU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Gja-Mir-221-P2a_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- ACCUGGCAUACAAUGUAGAAUUC -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Gja-Mir-221-P2a_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- AGCUACAUUGUCUGCUGGGUUUC -63
Get sequence
|






