| MirGeneDB ID | Gja-Mir-29-P1d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-29 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Schlegels Japanese gecko (Gekko japonicus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Gja-Mir-29-P1b-v1 Gja-Mir-29-P1d-v1 Gja-Mir-29-P2b Gja-Mir-29-P2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-29-P1 Aca-Mir-29-P1d-v1 Aga-Mir-29-P1 Agr-Mir-29-P1 Ami-Mir-29-P1d-v1 Asu-Mir-29-P1 Bfl-Mir-29-P1 Bla-Mir-29-P1 Bta-Mir-29-P1d7-v1 Bta-Mir-29-P1d8-v1 Cbr-Mir-29-P1 Cel-Mir-29-P1 Cfa-Mir-29-P1d-v1 Cin-Mir-29-o1 Cja-Mir-29-P1d-v1 Cli-Mir-29-P1d-v1 Cmi-Mir-29-P1d Cpi-Mir-29-P1d-v1 Cpo-Mir-29-P1d-v1 Csc-Mir-29-P1 Cte-Mir-29-P1 Dan-Mir-29-P1 Dgr-Mir-29-P1 Dlo-Mir-29-P1 Dma-Mir-29-P1 Dme-Mir-29-P1 Dmo-Mir-29-P1 Dno-Mir-29-P1d-v1 Dpu-Mir-29-P1 Dre-Mir-29-P1d1 Dre-Mir-29-P1d2 Dsi-Mir-29-P1 Dya-Mir-29-P1 Eba-Mir-29-P1 Eca-Mir-29-P1d-v1 Esc-Mir-29-P1 Ete-Mir-29-P1d-v1 Gga-Mir-29-P1d-v1 Gmo-Mir-29-P1d1 Gmo-Mir-29-P1d2 Gpa-Mir-29-P1 Gsp-Mir-29 Hme-Mir-29-P1 Hru-Mir-29-P1 Hsa-Mir-29-P1d-v1 Isc-Mir-29-P1 Laf-Mir-29-P1d-v1 Lch-Mir-29-P1d Lhy-Mir-29-P1 Llo-Mir-29-P1 Loc-Mir-29-P1d Mal-Mir-29-P1d1 Mal-Mir-29-P1d2-v1 Mdo-Mir-29-P1d-v1 Mgi-Mir-29-P1 Mml-Mir-29-P1d-v1 Mmr-Mir-29-P1d-v1 Mmu-Mir-29-P1d-v1 Mom-Mir-29-P1 Mun-Mir-29-P1d-v1 Npo-Mir-29-P1 Oan-Mir-29-P1d-v1 Obi-Mir-29-P1 Ocu-Mir-29-P1d-v1 Ofu-Mir-29-P1 Ovu-Mir-29-P1 Pab-Mir-29-P1d-v1 Pau-Mir-29-P1 Pbv-Mir-29-P1d-v1 Pcr-Mir-29-P1 Pdu-Mir-29-P1 Pfl-Mir-29-P1 Pmi-Mir-29-P1 Pve-Mir-29-P1 Rno-Mir-29-P1d5-v1 Rno-Mir-29-P1d6-v1 Rph-Mir-29-P1 Sha-Mir-29-P1d-v1 Sko-Mir-29-P1 Snu-Mir-29-P1 Spt-Mir-29-P1d Spu-Mir-29-P1 Sto-Mir-29-P1d Tca-Mir-29-P1 Tgu-Mir-29-P1d-v1 Tni-Mir-29-P1d1 Tni-Mir-29-P1d2 Tur-Mir-29-P1 War-Mir-29-P1 Xbo-Mir-29-P1 Xla-Mir-29-P1d3 Xla-Mir-29-P1d4 Xtr-Mir-29-P1d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_001447785.1_Gekko_japonicus) |
NW_015176027.1: 130054-130116 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-29-P1d-v2) |
Mir-29-P2d
NW_015176027.1: 127917-127976 [-]
Mir-29-P1d-v1 NW_015176027.1: 130053-130117 [-] Mir-29-P1d-v2 NW_015176027.1: 130054-130116 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Variant | Gja-Mir-29-P1d-v2 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UAGCACC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GUACAACAAGAGUGUGUCUUCCUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUCUAGGAGCAAGAAUUACAGCACUGGAUUUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GUACAACAAGAGUGUGU- C - -| C G U UUUUCC CUU CU CUGGAA GCUGGUUUCA AUGGUG CU AGAU A GAA GA GAUCUU UGACUAAAGU UACCAC GA UCUA U UUUAGGUCACGACAUUAA C G G^ U - - UGUUUC 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Gja-Mir-29-P1d-v2_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CUGGUUUCACAUGGUGGCUUAGAU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Gja-Mir-29-P1d-v2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- CUAGCACCAUUUGAAAUCAGUGU -63
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Variant | Gja-Mir-29-P1d-v1 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AGCACCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UGUACAACAAGAGUGUGUCUUCCUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUCUAGGAGCAAGAAUUACAGCACUGGAUUUGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 UGUACAACAAGAGUGUG- C - -| C G U UUUUUCC UCUU CU CUGGAA GCUGGUUUCA AUGGUG CU AGA A AGAA GA GAUCUU UGACUAAAGU UACCAC GA UCU U GUUUAGGUCACGACAUUA C G G^ U - - AUGUUUC 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Gja-Mir-29-P1d-v1_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GCUGGUUUCACAUGGUGGCUUAGA -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Gja-Mir-29-P1d-v1_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
42- UAGCACCAUUUGAAAUCAGUGUU -65
Get sequence
|






