| MirGeneDB ID | Mmr-Let-7-P2c1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | LET-7 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Gray mouse lemur (Microcebus murinus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Mmr-Let-7-P1b Mmr-Let-7-P1c Mmr-Let-7-P1d Mmr-Let-7-P2a1 Mmr-Let-7-P2a2 Mmr-Let-7-P2a3 Mmr-Let-7-P2b1 Mmr-Let-7-P2b2 Mmr-Let-7-P2b3 Mmr-Let-7-P2c2 Mmr-Let-7-P2c3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Let-7 Aca-Let-7-P2c1 Aga-Let-7 Agr-Let-7 Ami-Let-7-P2c1 Bge-Let-7 Bko-Let-7 Bpl-Let-7 Bta-Let-7-P2c1 Cfa-Let-7-P2c1 Cja-Let-7-P2c1 Cli-Let-7-P2c1 Cmi-Let-7-P2c1 Cpi-Let-7-P2c1 Cpo-Let-7-P2c1 Cte-Let-7 Dan-Let-7 Dlo-Let-7 Dma-Let-7 Dme-Let-7 Dmo-Let-7 Dno-Let-7-P2c1 Dpu-Let-7 Dsi-Let-7 Dya-Let-7 Eba-Let-7 Eca-Let-7-P2c1 Egr-Let-7 Esc-Let-7 Ete-Let-7-P2c1 Gga-Let-7-P2c1 Gja-Let-7-P2c1 Gpa-Let-7 Gsa-Let-7 Gsp-Let-7 Hme-Let-7 Hmi-Let-7 Hru-Let-7 Hsa-Let-7-P2c1 Isc-Let-7 Laf-Let-7-P2c1 Lan-Let-7 Lch-Let-7-P2c1 Lgi-Let-7 Lhy-Let-7 Llo-Let-7 Loc-Let-7-P2c1 Mdo-Let-7-P2c1 Mgi-Let-7 Mml-Let-7-P2c1 Mmu-Let-7-P2c1 Mom-Let-7 Mun-Let-7-P2c1 Neu-Let-7-P2c1 Npo-Let-7 Oan-Let-7-P2c1 Obi-Let-7 Ocu-Let-7-P2c1 Ofu-Let-7 Ovu-Let-7 Pab-Let-7-P2c1 Pau-Let-7 Pbv-Let-7-P2c1 Pca-Let-7 Pcr-Let-7 Pdu-Let-7 Pfl-Let-7 Ple-Let-7 Pmi-Let-7 Pve-Let-7 Rno-Let-7-P2c1 Rph-Let-7 Sha-Let-7-P2c1 Sko-Let-7 Sma-Let-7 Sne-Let-7 Snu-Let-7 Spt-Let-7-P2c1 Spu-Let-7 Sro-Let-7 Sto-Let-7-P2c1 Tca-Let-7 Tgu-Let-7-P2c1 Tur-Let-7 War-Let-7 Xbo-Let-7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000165445.3_Mmur_3.0_genomic) |
CM007670.1: 4933070-4933144 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Let-7-P2c1) |
Let-7-P2a1
CM007670.1: 4930441-4930512 [+]
UCSC
Ensembl
Let-7-P2b1 CM007670.1: 4930829-4930905 [+] UCSC Ensembl Let-7-P2c1 CM007670.1: 4933070-4933144 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GAGGUAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GGCAAGAAAAUAAAAAAUGGGUUCCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGGGAUUUUGCCCACACGGAGGUAACUAUACGACCUGCUGCCUUUCUUAGGGCCUCAUUAUUCCACGGUAACCUGUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GGCAAGAAAAUAAAAAA--| UU A C UUAGGGCAGGGAUU UGGG CCUAGGA GAGGUAGUAGGUUG AUAGUU U ACUC GGAUUCU UUCCGUCGUCCAGC UAUCAA U UGUCCAAUGGCACCUUAUU^ CG - A UGGAGGCACACCCG 130 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | This is a Group 2 in human according to Kim et al. (2017) but because there is a templated 3' U it is not possible according to read data to classify it as such in other taxa although the secondary structure is consistent with this categorization. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Mmr-Let-7-P2c1_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGAGGUAGUAGGUUGCAUAGUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Mmr-Let-7-P2c1_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
54- CUAUACGACCUGCUGCCUUUC -75
Get sequence
|






