| MirGeneDB ID | Mom-Mir-2-o85 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Mossy chiton (Mopalia muscosa) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Mom-Mir-2-o86 Mom-Mir-2-o88 Mom-Mir-2-o89 Mom-Mir-2-P12f Mom-Mir-2-P12g Mom-Mir-2-P12h Mom-Mir-2-P12i Mom-Mir-2-P12j Mom-Mir-2-P12k | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Agr-Mir-2-o85 Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Polyplacophora | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_031763545.1_ASM3176354v1_genomic_Mom) |
JARFOD010000037.1: 49292-49353 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o85-v1) |
Mir-71
JARFOD010000037.1: 48527-48588 [+]
Ensembl
Mir-2-o85-v1 JARFOD010000037.1: 49292-49353 [+] Ensembl Mir-2-o85-v2 JARFOD010000037.1: 49292-49352 [+] Ensembl Mir-2-o88 JARFOD010000037.1: 52221-52280 [+] Ensembl Mir-2-o89 JARFOD010000037.1: 52665-52722 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Variant | Mom-Mir-2-o85-v1 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CACAGCC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GACCAAAAGGGUGGCUUGUGACAUUCGUGGACGUCAAUGCUGGUAUGUAGUAGCCAGCUGACAAGCUCUAUCACAGCCAGCUUUGAUGAGCCAUGCCUGUCACCUAAUCAGCUUUAAUCAGCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GACCAAAAGGGUGGCUU-- UU A-| U A A GCCAGCU GUGACA CGUGG CGUCAA GCUGGU UGU GUA G CACUGU GUACC GUAGUU CGACCG ACA UAU A CGACUAAUUUCGACUAAUC CC GA^ U - C CUCGAAC 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Mom-Mir-2-o85-v1_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- ACGUCAAUGCUGGUAUGUAGUA -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Mom-Mir-2-o85-v1_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- UCACAGCCAGCUUUGAUGAGCC -62
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Variant | Mom-Mir-2-o85-v2 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GACCAAAAGGGUGGCUUGUGACAUUCGUGGACGUCAAUGCUGGUAUGUAGUAGCCAGCUGACAAGCUCUAUCACAGCCAGCUUUGAUGAGCCAUGCCUGUCACCUAAUCAGCUUUAAUCAGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GACCAAAAGGGUGGCUU- UU A-| U A A CCAGCU GUGACA CGUGG CGUCAA GCUGGU UGU GUAG G CACUGU GUACC GUAGUU CGACCG ACA UAUC A GACUAAUUUCGACUAAUC CC GA^ U - C UCGAAC . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Mom-Mir-2-o85-v2_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- ACGUCAAUGCUGGUAUGUAGUAGC -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Mom-Mir-2-o85-v2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UAUCACAGCCAGCUUUGAUGAGC -61
Get sequence
|






