| MirGeneDB ID | Mun-Mir-17-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-17 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Microcaecilia (Microcaecilia unicolor) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Mun-Mir-17-P1a Mun-Mir-17-P1c Mun-Mir-17-P2a Mun-Mir-17-P4a Mun-Mir-17-P4d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-17-P2c Ami-Mir-17-P2c Bta-Mir-17-P2c Cfa-Mir-17-P2c Cja-Mir-17-P2c Cli-Mir-17-P2c Cmi-Mir-17-P2c Cpi-Mir-17-P2c Cpo-Mir-17-P2c Dno-Mir-17-P2c Dre-Mir-17-P2c Eca-Mir-17-P2c Ete-Mir-17-P2c Gga-Mir-17-P2c Gja-Mir-17-P2c Gmo-Mir-17-P2c Hsa-Mir-17-P2c Laf-Mir-17-P2c Lch-Mir-17-P2c Loc-Mir-17-P2c Mdo-Mir-17-P2c Mml-Mir-17-P2c Mmr-Mir-17-P2c Mmu-Mir-17-P2c Neu-Mir-17-P2c Oan-Mir-17-P2c Ocu-Mir-17-P2c Pab-Mir-17-P2c Pbv-Mir-17-P2c Rno-Mir-17-P2c Sha-Mir-17-P2c Spt-Mir-17-P2c Sto-Mir-17-P2c Tgu-Mir-17-P2c Xla-Mir-17-P2c3 Xla-Mir-17-P2c4 Xtr-Mir-17-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_901765095.2_aMicUni1.2) |
LR594638.1: 44966461-44966525 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-17-P2c) |
Mir-17-P1c
LR594638.1: 44966335-44966391 [+]
Mir-17-P2c LR594638.1: 44966461-44966525 [+] Mir-19-P2c LR594638.1: 44966841-44966899 [+] Mir-92-P1c LR594638.1: 44966992-44967054 [+] Mir-92-P2c LR594638.1: 44967139-44967203 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAGGUGC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GGAAUCUCCAUCUUCACAAAUUUCUUGUGUUAAGGUGCAUCUAGUGCAGUUAGUGGCGUAGUCUAGAAUCUACUGCCCUAAAUGCUCCUUCUGGCACAAGGGACUUCAUAUACCUCGUGUUUGAUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GGAAUCUCCAUCUUCACAAA-- UU --| U C U U UGGCGUA U CUUGUGUUA AGG GCAU UAG GCAGU AG G A GAACACGGU UCC CGUA AUC CGUCA UC U UAGUUUGUGCUCCAUAUACUUC GG CU^ U A C - UAAGAUC 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Mun-Mir-17-P2c_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UAAGGUGCAUCUAGUGCAGUUAG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Mun-Mir-17-P2c_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- UACUGCCCUAAAUGCUCCUUCUGGC -65
Get sequence
|






