| MirGeneDB ID | Ocu-Mir-451 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-451 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Rabbit (Oryctolagus cuniculus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-451 Ami-Mir-451 Bta-Mir-451 Cfa-Mir-451 Cja-Mir-451 Cli-Mir-451 Cmi-Mir-451 Cpi-Mir-451 Cpo-Mir-451 Dno-Mir-451 Dre-Mir-451 Ebu-Mir-451 Eca-Mir-451 Ete-Mir-451 Gga-Mir-451 Gja-Mir-451 Gmo-Mir-451 Hsa-Mir-451 Laf-Mir-451 Lch-Mir-451 Loc-Mir-451 Mal-Mir-451 Mdo-Mir-451 Mml-Mir-451 Mmr-Mir-451 Mmu-Mir-451 Mun-Mir-451 Neu-Mir-451 Oan-Mir-451 Pab-Mir-451 Pma-Mir-451 Rno-Mir-451 Sha-Mir-451 Spt-Mir-451 Sto-Mir-451 Tgu-Mir-451 Tni-Mir-451 Xla-Mir-451-P1 Xla-Mir-451-P2 Xtr-Mir-451 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (oryCun2_add) |
chr19: 19330477-19330518 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-451) |
Mir-144-v1
chr19: 19330299-19330356 [+]
UCSC
Ensembl
Mir-144-v2 chr19: 19330299-19330356 [+] UCSC Ensembl Mir-451 chr19: 19330477-19330518 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AACCGUU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CCACUCCCCGUGCACUUGGGAAUGGCGAGGAAACCGUUACCAUUACUGAGUUUAGUAAUGGUAACGGUUCUCUUGCUGUACCCAGAAAAUGUGCCAGGAAGAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CCACUCCCCGUGCACUU--| A GA A GGG AUGGCGAG AACCGUUACCAUUACUG G CCC UGUCGUUC UUGGCAAUGGUAAUGAU U AGAAGGACCGUGUAAAAGA^ A UC U 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | As a non-canonical (Group 4, Kim et al. 2016) miRNA there is no discrete 3p read and the 3' end of the mature miRNA is somewhat arbitrary. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | NA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ocu-Mir-451_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AAACCGUUACCAUUACUGAGUU -22
Get sequence
|






