| MirGeneDB ID | Ofu-Mir-2-o153 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Tubeworm (Owenia fusiformis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ofu-Mir-2-o154 Ofu-Mir-2-o155 Ofu-Mir-2-o156 Ofu-Mir-2-o157 Ofu-Mir-2-o158 Ofu-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | O. fusiformis | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_903813345.2_Owenia) |
CAIIXF020000003.1: 15958470-15958526 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o153) |
Mir-71
CAIIXF020000003.1: 15950516-15950575 [+]
Mir-2-o153 CAIIXF020000003.1: 15958470-15958526 [+] Mir-2-P12 CAIIXF020000003.1: 15958948-15959009 [+] Mir-2-o154 CAIIXF020000003.1: 15959506-15959565 [+] Mir-2-o155 CAIIXF020000003.1: 15960009-15960067 [+] Mir-2-o156 CAIIXF020000003.1: 15960548-15960608 [+] Mir-2-o157 CAIIXF020000003.1: 15962486-15962544 [+] Mir-2-o158 CAIIXF020000003.1: 15964675-15964734 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CACAGCC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GACGUGUACAAGAGAUACGUGUGACUUAGGAGUCACUGCUGGCCGCCGAUAGUGACAUUGACCUAUCACAGCCAGCAUUGAUGAGCCUAGUUACAUUGCAGCUCCACCUAUUAGUGUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GACGUGUACAAGAGAUAC--- U A--| C CGCC GUGAC GUGUGAC UAGG GUCA UGCUGGC GAUA A UACAUUG AUCC UAGU ACGACCG CUAU U UGUGAUUAUCCACCUCGACGU - GAG^ U ACA- CCAGU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ofu-Mir-2-o153_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGUCACUGCUGGCCGCCGAUA -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ofu-Mir-2-o153_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- UCACAGCCAGCAUUGAUGAGCC -57
Get sequence
|






