| MirGeneDB ID | Ofu-Mir-279-o55 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-279 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Tubeworm (Owenia fusiformis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ofu-Mir-279-o53 Ofu-Mir-279-o54 Ofu-Mir-279-o56 Ofu-Mir-279-o57 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Agr-Mir-279 Bpl-Mir-279 Eba-Mir-279 Egr-Mir-279 Esc-Mir-279 Gsa-Mir-279 Gsp-Mir-279 Hru-Mir-279 Isc-Mir-279 Lgi-Mir-279 Lhy-Mir-279 Llo-Mir-279 Mgi-Mir-279 Mom-Mir-279 Npo-Mir-279 Obi-Mir-279 Ovu-Mir-279 Pau-Mir-279 Pcr-Mir-279 Pve-Mir-279 Rph-Mir-279 Sma-Mir-279 Sne-Mir-279 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | O. fusiformis | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_903813345.2_Owenia) |
CAIIXF020000005.1: 28263348-28263402 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-279-o55) |
Mir-279-o57
CAIIXF020000005.1: 28262369-28262425 [+]
Mir-279-o53 CAIIXF020000005.1: 28262820-28262871 [+] Mir-279-o55 CAIIXF020000005.1: 28263348-28263402 [+] Mir-279-o54 CAIIXF020000005.1: 28263645-28263699 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GACUAGA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CAUGUGGAUUCAUAUAUUGUGGUUACUUUGAUGUGUGUAUGUCGAGUCCAUGUUAUUUACGUCAUGACUAGAUAUACACUCAUUACUGUGGCUAACAGAACAAUUCAAUUCAAACGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CAUGUGGAUUCAUAUAU- -| UU U G C UUAU UG UGGUUAC UGAUG GUGUAUGUC AGUC AUG U AC AUCGGUG AUUAC CACAUAUAG UCAG UAC U CAAACUUAACUUAACAAG A^ UC U A - UGCA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of annelids thus these multiple paralogues are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ofu-Mir-279-o55_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AUGUGUGUAUGUCGAGUCCAUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ofu-Mir-279-o55_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
34- UGACUAGAUAUACACUCAUUA -55
Get sequence
|






