| MirGeneDB ID | Pbv-Mir-27-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-27 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Burmese python (Python bivittatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pbv-mir-27a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pbv-Mir-27-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-27-P3 Ami-Mir-27-P3 Bta-Mir-27-P3 Cfa-Mir-27-P3 Cja-Mir-27-P3 Cmi-Mir-27-P3 Cpi-Mir-27-P3 Cpo-Mir-27-P3 Dno-Mir-27-P3 Dre-Mir-27-P3 Eca-Mir-27-P3 Ete-Mir-27-P3 Gga-Mir-27-P3 Gja-Mir-27-P3 Gmo-Mir-27-P3 Hsa-Mir-27-P3 Laf-Mir-27-P3 Lch-Mir-27-P3 Loc-Mir-27-P3 Mal-Mir-27-P3 Mdo-Mir-27-P3 Mml-Mir-27-P3 Mmr-Mir-27-P3 Mmu-Mir-27-P3 Neu-Mir-27-P3 Oan-Mir-27-P3 Ocu-Mir-27-P3 Pab-Mir-27-P3 Rno-Mir-27-P3 Sha-Mir-27-P3 Sto-Mir-27-P3a Sto-Mir-27-P3b Tgu-Mir-27-P3 Tni-Mir-27-P3 Xla-Mir-27-P3c Xla-Mir-27-P3d Xtr-Mir-27-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000186305.2_Python_molurus_bivittatus) |
KE953590.1: 99842-99903 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-27-P3) |
Mir-24-P3
KE953590.1: 99568-99627 [-]
Mir-27-P3 KE953590.1: 99842-99903 [-] Mir-23-P3 KE953590.1: 100352-100412 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GGGCUUA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GAGACAGGGAUUCCUCAGACUGCCUAGGGUAGGGCUUAGCUCACUUGUGAACAGCGUUUGGUUCAGCCGUGUUCACAGUGGCUAAGUUCCGCCACUUGGAGUCCAUUCUCUCCUCUGCGCAUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GAGACAGGGAUUCCUCA--| G U - UA U U GCGUUUG GACU CC AG GG GGGCUUAGC CACU GUGAACA G CUGA GG UC CC CUUGAAUCG GUGA CACUUGU U UACGCGUCUCCUCUCUUAC^ - U A GC - - GCCGACU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pbv-Mir-27-P3_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038861 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGGCUUAGCUCACUUGUGAACA -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Co-mature sequence | Pbv-Mir-27-P3_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038862 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
41- UUCACAGUGGCUAAGUUCCGC -62
Get sequence
|






