| MirGeneDB ID | Pca-Mir-279-o31 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-279 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Penis worm (Priapulus caudatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pca-Mir-279-o27 Pca-Mir-279-o28 Pca-Mir-279-o29 Pca-Mir-279-o30 Pca-Mir-279-o32 Pca-Mir-279-o33 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Agr-Mir-279 Bpl-Mir-279 Eba-Mir-279 Egr-Mir-279 Esc-Mir-279 Gsa-Mir-279 Gsp-Mir-279 Hru-Mir-279 Isc-Mir-279 Lgi-Mir-279 Lhy-Mir-279 Llo-Mir-279 Mgi-Mir-279 Mom-Mir-279 Npo-Mir-279 Obi-Mir-279 Ovu-Mir-279 Pau-Mir-279 Pcr-Mir-279 Pve-Mir-279 Rph-Mir-279 Sma-Mir-279 Sne-Mir-279 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | P. caudatus | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Priapulus_caudatus_gca000485595v2) |
KQ716181.1: 67909-67966 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-279-o31) |
Mir-92-o97
KQ716181.1: 38405-38465 [-]
UCSC
Ensembl
Mir-279-o33 KQ716181.1: 66996-67057 [-] UCSC Ensembl Mir-279-o32 KQ716181.1: 67725-67783 [-] UCSC Ensembl Mir-279-o31 KQ716181.1: 67909-67966 [-] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GACUAGA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CAAGAUAUGCAUUGAGUAUGAGUUGCUAUUGGUUUGUAGAACUCUAGUCCAUGUAGUAUAUAAUCAUGACUAGAGCCCUACUCACCAUUAGACACUCUGAUGUGGCAGUUGAGCUGUGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CAAGAUAUGCAUUGAGUAU--| UG U UU AA C UAGUA GAGU CUA UGGU GUAG CUCUAGUC AUG \ CUCA GAU ACCA CAUC GAGAUCAG UAC U GUGUCGAGUUGACGGUGUAGU^ CA U CU CC - UAAUA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of ecdysozoans and how the priapulid Mir-279s relate to the Mir-279s in nematodes or arthropods and thus these multiple paralogues are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pca-Mir-279-o31_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGUUUGUAGAACUCUAGUCCAUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pca-Mir-279-o31_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
36- UGACUAGAGCCCUACUCACCAU -58
Get sequence
|






