| MirGeneDB ID | Pcr-Mir-10-P4t | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-10 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Tiger flatworm (Prostheceraeus crozieri ) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pcr-Mir-10-P1o4-v1 Pcr-Mir-10-P1o5 Pcr-Mir-10-P3 Pcr-Mir-10-P4s1 Pcr-Mir-10-P4s2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-10-P4 Adi-Mir-10 Aga-Mir-10-P4 Asp-Mir-10 Asu-Mir-10-P4 Ava-Mir-10-P4 Bge-Mir-10-P4 Bpl-Mir-10-P4 Cte-Mir-10-P4 Dan-Mir-10-P4 Dgr-Mir-10-P4 Dlo-Mir-10-P4-v1 Dma-Mir-10-P4 Dme-Mir-10-P4 Dmo-Mir-10-P4 Dpu-Mir-10-P4 Dsi-Mir-10-P4 Dya-Mir-10-P4 Gpa-Mir-10-P4 Gsa-Mir-10-P4 Hme-Mir-10-P4 Isc-Mir-10-P4 Llo-Mir-10-P4-v1 Nve-Mir-10 Ofu-Mir-10-P4 Pca-Mir-10-P4 Pdu-Mir-10-P4 Pdu-Mir-10-P4-as Snu-Mir-10-P4 Tca-Mir-10-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | P. crozeri | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Eumetazoa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_907163375.1_PROCRO_GENOME_genomic) |
CAJQUW010006474.1: 165854-165911 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAGCUCU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UAGAUGGAAGUGAACAACAUGUGAGUGUCAUACCCUGUAGAUCCGGGUUUUUGCCCUUCUGUUACAGAAGCUCUGACCUACAGGUAUGCAUCUUGUGUUUAAAGCGACUUUCCGGAAAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UAGAUGGAAGUGAACAAC-- UG -| U C A C CCCUU AUG AG UG CAUACC UGUAG UC GGGUUUUUG \ UGU UC AC GUAUGG ACAUC AG CUCGAAGAC C AAAGGCCUUUCAGCGAAAUU GU U^ - - C U AUUGU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pcr-Mir-10-P4t_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UACCCUGUAGAUCCGGGUUUUUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pcr-Mir-10-P4t_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
36- GAAGCUCUGACCUACAGGUAUG -58
Get sequence
|






