| MirGeneDB ID | Pcr-Mir-2-o159 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Tiger flatworm (Prostheceraeus crozieri ) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pcr-Mir-2-o160 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | P. crozeri | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_907163375.1_PROCRO_GENOME_genomic) |
CAJQUW010002633.1: 636086-636150 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o159) |
Mir-71-v1
CAJQUW010002633.1: 635983-636044 [+]
Ensembl
Mir-71-v2 CAJQUW010002633.1: 635985-636042 [+] Ensembl Mir-2-o159 CAJQUW010002633.1: 636086-636150 [+] Ensembl Mir-2-o160 CAJQUW010002633.1: 636207-636265 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CACAGCC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CGGUCGUCUAUCAUCAUACCAUCUCGUUGGUCGUCAAUAUUGUCUGUCGGUAGUGAUUCAAUGUAAAAACUUAUCACAGCCAGUAUUGAUGAGCCAGUUGGAAGGUUUGAAGCCACACUUUUCCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CGGUCGUCUAUCAUCAU-- A CG -| U C GUGAUUCAA ACC UCU UUGG UCGUCAAUAUUG CUGU GGUA \ UGG AGG GACC AGUAGUUAUGAC GACA CUAU U UCCUUUUCACACCGAAGUU A UU G^ C - UCAAAAAUG 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pcr-Mir-2-o159_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UCGUCAAUAUUGUCUGUCGGUA -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pcr-Mir-2-o159_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
43- UCACAGCCAGUAUUGAUGAGCC -65
Get sequence
|






