| MirGeneDB ID | Pfl-Mir-10-P3j2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-10 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Ptychodera (Ptychodera flava) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pfl-Mir-10-P1 Pfl-Mir-10-P2 Pfl-Mir-10-P3j1 Pfl-Mir-10-P3k | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-10-P3 Adi-Mir-10 Aga-Mir-10-P3 Agr-Mir-10-P3 Asp-Mir-10 Asu-Mir-10-P3 Bfl-Mir-10-P3 Bge-Mir-10-P3 Bko-Mir-10-P3 Bla-Mir-10-P3 Bpl-Mir-10-P3 Cin-Mir-10-P3 Cte-Mir-10-P3 Dan-Mir-10-P3 Dlo-Mir-10-P3 Dma-Mir-10-P3 Dme-Mir-10-P3 Dmo-Mir-10-P3 Dpu-Mir-10-P3 Dsi-Mir-10-P3 Dya-Mir-10-P3 Eba-Mir-10-P3 Egr-Mir-10-P3 Esc-Mir-10-P3 Gpa-Mir-10-P3 Gsa-Mir-10-P3 Gsp-Mir-10-P3 Hru-Mir-10-P3 Isc-Mir-10-P3 Lan-Mir-10-P3 Lgi-Mir-10-P3 Lhy-Mir-10-P3 Llo-Mir-10-P3 Mgi-Mir-10-P3 Mom-Mir-10-P3 Nag-Mir-10-P3-v1 Nve-Mir-10 Obi-Mir-10-P3 Ofu-Mir-10-P3 Ovu-Mir-10-P3 Pau-Mir-10-P3 Pca-Mir-10-P3 Pcr-Mir-10-P3 Pdu-Mir-10-P3 Ple-Mir-10-P3 Pmi-Mir-10-P3 Pve-Mir-10-P3 Rph-Mir-10-P3 Sko-Mir-10-P3 Snu-Mir-10-P3 Spu-Mir-10-P3 Tca-Mir-10-P3 War-Mir-10-P3 Xbo-Mir-10-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | P. flava | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Eumetazoa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Pfl) |
LD348914.1: 17512-17570 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-10-P3j2) |
Mir-10-P3j1
LD348914.1: 17512-17570 [+]
Mir-10-P3j2 LD348914.1: 17512-17570 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CCCUGAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
ACCCACGAUACCGUUCAGUGUGCUCCCCGAUCCCUGAGACCCUAACUUGUGAUGUUACCCACAAUUCACAGGUUAGUUGCUCAGGUACUGGGUGGCAUAAAUGAGCUCCAAGACGUUUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 ACCCACGAUACCGUUCAG--| UC AUC ACC UGUUAC UGUGC CCCG CCUGAG CUAACUUGUGA \ AUACG GGGU GGACUC GAUUGGACACU C CUUUGCAGAACCUCGAGUAA^ GU CAU GUU UAACAC 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pfl-Mir-10-P3j2_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UCCCUGAGACCCUAACUUGUGA -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pfl-Mir-10-P3j2_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- ACAGGUUAGUUGCUCAGGUACU -59
Get sequence
|






