| MirGeneDB ID | Pmi-Mir-22-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-22 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Bat starfish (Patiria miniata) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pmi-mir-22 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-22-P2 Aga-Mir-22-P2 Agr-Mir-22-P2 Asu-Mir-22-P2 Bfl-Mir-22-P2a Bfl-Mir-22-P2b Bfl-Mir-22-P2c Bge-Mir-22-P2 Bla-Mir-22-P2a Bla-Mir-22-P2b Bla-Mir-22-P2c Cbr-Mir-22-P2-v1 Cel-Mir-22-P2 Csc-Mir-22-P2 Cte-Mir-22-P2 Dan-Mir-22-P2 Dlo-Mir-22-P2 Dma-Mir-22-P2 Dme-Mir-22-P2 Dmo-Mir-22-P2 Dpu-Mir-22-P2 Dsi-Mir-22-P2 Dya-Mir-22-P2 Eba-Mir-22-P2 Esc-Mir-22-P2 Gpa-Mir-22-P2 Hme-Mir-22-P2 Hru-Mir-22-P2 Isc-Mir-22-P2 Lan-Mir-22-P2 Lgi-Mir-22-P2 Lhy-Mir-22-P2 Llo-Mir-22-P2 Lpo-Mir-22-P2f Lpo-Mir-22-P2g Lpo-Mir-22-P2h Lpo-Mir-22-P2i Mgi-Mir-22-P2 Mom-Mir-22-P2 Npo-Mir-22-P2 Ofu-Mir-22-P2j Ofu-Mir-22-P2k Ovu-Mir-22-P2 Pau-Mir-22-P2 Pca-Mir-22-P2 Pcr-Mir-22-P2l Pcr-Mir-22-P2m Pdu-Mir-22-P2 Pfl-Mir-22-P2 Pve-Mir-22-P2 Rph-Mir-22-P2 Sko-Mir-22-P2 Snu-Mir-22-P2 Spu-Mir-22-P2 Tca-Mir-22-P2-v1 Tur-Mir-22-P2 War-Mir-22-P2 Xbo-Mir-22-P2d Xbo-Mir-22-P2e | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Pmin1) |
JH783623.1: 312-377 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-22-P2) |
Mir-22-P2
JH783623.1: 312-377 [+]
Mir-103 JH783623.1: 1378-1440 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CAGCUGC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CCCACGUUUGUUUUUGUCUGCCGUGCGGUCACAUUUCACUGGUGGGCUGAUGCGUCCGAUCUUUCUAAACACCAUCAGCUGCCCGGUGAAGUGUAGUCGCGCGGACAGGUGGUCUGCGAAGUAUCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CCCACGUUUGUUUUUGU- -| UC UG CGUCCGAUC CUG CCGUGCGG ACAUUUCACUGG GGCUGAUG U GAC GGCGCGCU UGUGAAGUGGCC UCGACUAC U UCUAUGAAGCGUCUGGUG A^ GA CG CACAAAUCU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is unclear if this paralogue group represents the ancestral Mir-22-P2 gene that is seed shifted or a new paralogue derived from the ancestral P1 gene. It is also unclear if this gene is orthologous to the Mir-22-o1 gene in Branchiostoma and Xenoturbella. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pmi-Mir-22-P2_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- ACAUUUCACUGGUGGGCUGAUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pmi-Mir-22-P2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0032144 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
44- UCAGCUGCCCGGUGAAGUGUAG -66
Get sequence
|






