| MirGeneDB ID | Pve-Mir-2-o74 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Vernerds tusk shell (Pictodentalium vernedei) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pve-Mir-2-o74-v1 Pve-Mir-2-o75-v1 Pve-Mir-2-o76-v1 Pve-Mir-2-o77 Pve-Mir-2-o78-v1 Pve-Mir-2-o79 Pve-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Dentaliidae | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Pve_genome_chr_only) |
Pve_Chr8: 484570188-484570248 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o74-v2) |
Mir-2-o79
Pve_Chr8: 484544223-484544280 [-]
Ensembl
Mir-2-o78-v2 Pve_Chr8: 484544606-484544663 [-] Ensembl Mir-2-o78-v1 Pve_Chr8: 484544606-484544663 [-] Ensembl Mir-2-o77 Pve_Chr8: 484550374-484550431 [-] Ensembl Mir-2-o76-v1 Pve_Chr8: 484550545-484550603 [-] Ensembl Mir-2-o76-v2 Pve_Chr8: 484550545-484550603 [-] Ensembl Mir-2-o75-v2 Pve_Chr8: 484566363-484566425 [-] Ensembl Mir-2-o75-v1 Pve_Chr8: 484566363-484566425 [-] Ensembl Mir-2-P12 Pve_Chr8: 484566495-484566554 [-] Ensembl Mir-2-o74-v2 Pve_Chr8: 484570188-484570248 [-] Ensembl Mir-2-o74-v1 Pve_Chr8: 484570189-484570248 [-] Ensembl Mir-71 Pve_Chr8: 484570428-484570486 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Variant | Pve-Mir-2-o74-v2 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CACAGCC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUUGCUGAUUUUUUUGUGCUGCUGCUGUGGCCGUCAAUGCUGGAUGUAGUAGUAAUCCACUUGGUUCUAUCACAGCCAGCUUUGAUGAGCCAUAUCUUCAAGCUUGCUUCAACUAUCAGUAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AUUGCUGAUUUUUUUGU- GCUGC- -| U A A GUAAUCC GCU UGUGGC CGUCAA GCUGG UGU GUA A CGA AUACCG GUAGUU CGACC ACA UAU C AUGACUAUCAACUUCGUU ACUUCU A^ U G C CUUGGUU . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pve-Mir-2-o74-v2_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CCGUCAAUGCUGGAUGUAGUA -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pve-Mir-2-o74-v2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
39- UCACAGCCAGCUUUGAUGAGCC -61
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Variant | Pve-Mir-2-o74-v1 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUUGCUGAUUUUUUUGUGCUGCUGCUGUGGCCGUCAAUGCUGGAUGUAGUAGUAAUCCACUUGGUUCUAUCACAGCCAGCUUUGAUGAGCCAUAUCUUCAAGCUUGCUUCAACUAUCAGUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AUUGCUGAUUUUUUUGUGCUGCUGC- -| U A A UAAUCC UGUGGC CGUCAA GCUGG UGU GUAG A AUACCG GUAGUU CGACC ACA UAUC C UGACUAUCAACUUCGUUCGAACUUCU A^ U G C UUGGUU . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pve-Mir-2-o74-v1_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CCGUCAAUGCUGGAUGUAGUAGU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pve-Mir-2-o74-v1_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- UAUCACAGCCAGCUUUGAUGAGC -60
Get sequence
|






