| MirGeneDB ID | Snu-Mir-2-o43 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Peanut worm (Sipunculus nudus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Snu-Mir-2-o40-v1 Snu-Mir-2-o41 Snu-Mir-2-o42-v1 Snu-Mir-2-o44 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | S. nudus | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_026874595.1_ASM2687459v1_Sipunculus_nudus) |
CM049316.1: 13595017-13595073 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o43) |
Mir-71
CM049316.1: 13592864-13592924 [+]
Mir-2-o40-v2 CM049316.1: 13593314-13593376 [+] Mir-2-o40-v1 CM049316.1: 13593316-13593374 [+] Mir-2-o41 CM049316.1: 13593873-13593932 [+] Mir-2-o42-v2 CM049316.1: 13594489-13594550 [+] Mir-2-o42-v1 CM049316.1: 13594492-13594547 [+] Mir-2-o43 CM049316.1: 13595017-13595073 [+] Mir-2-o44 CM049316.1: 13596008-13596064 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CCAGCUUAACCCAGAUUGCCAGCCCCAAGGCAUCAAAGUGGUGGUGAUGUGCGGAAGUAUGUUCAUAUCACAGCCAGCUUUGAUGAGCUUGGUGCAGGGUGGUGGCACUUCAUAAUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CCAGCUUAACCCAGAUUG- A C G- -| G CGGAA CC GC CCAAG CAUCAAAG UGGU GUGAUGUG G GG CG GGUUC GUAGUUUC ACCG CACUAUAC U CUAAUACUUCACGGUGGUG A U GA G^ A UUGUA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Snu-Mir-2-o43_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CAUCAAAGUGGUGGUGAUGUG -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Snu-Mir-2-o43_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- UAUCACAGCCAGCUUUGAUGAG -57
Get sequence
|






