| MirGeneDB ID | Snu-Mir-216-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-216 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Peanut worm (Sipunculus nudus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Snu-Mir-216-P2c Snu-Mir-216-P2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-216-P1 Aga-Mir-216-P1 Agr-Mir-216-P1 Asu-Mir-216-P1 Bge-Mir-216-P1 Cte-Mir-216-P1 Dan-Mir-216-P1 Dgr-Mir-216-P1 Dlo-Mir-216-P1 Dma-Mir-216-P1 Dme-Mir-216-P1 Dmo-Mir-216-P1 Dpu-Mir-216-P1 Dsi-Mir-216-P1 Dya-Mir-216-P1 Eba-Mir-216-P1 Efe-Mir-216-P1a Efe-Mir-216-P1b Esc-Mir-216-P1 Gpa-Mir-216-P1 Hme-Mir-216-P1 Hru-Mir-216-P1 Lan-Mir-216-P1e Lan-Mir-216-P1f Lgi-Mir-216-P1 Lhy-Mir-216-P1 Mgi-Mir-216-P1 Mom-Mir-216-P1 Ofu-Mir-216-P1 Pau-Mir-216-P1 Pca-Mir-216-P1 Pcr-Mir-216-P1 Pdu-Mir-216-P1 Pve-Mir-216-P1 Rph-Mir-216-P1 Sma-Mir-216-P1 Tca-Mir-216-P1 War-Mir-216-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Nephrozoa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Nephrozoa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_026874595.1_ASM2687459v1_Sipunculus_nudus) |
CM049308.1: 11132643-11132702 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-216-P1) |
Mir-12
CM049308.1: 11128211-11128272 [-]
Mir-216-P2d CM049308.1: 11130439-11130498 [-] Mir-216-P1 CM049308.1: 11132643-11132702 [-] Mir-216-P2c CM049308.1: 11133197-11133256 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAUAUCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GUAUGUGUAUAUACAGAAGACCUGCUUCUCUAAUAUCAGCUGGUAAUUCAGAGGCUGUGCUGUCACUCUGGAUGCUGCCUGAUAUUUUGAGGAACAGCGUGCUUAAGUCUGCUUUCACCAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GUAUGUGUAUAUACAGAAG- - C U-| CU A GCUGU AC CUG UUCUC AAUAUCAG GGUA UUCAGAG G UG GAC AGGAG UUAUAGUC UCGU AGGUCUC C ACCACUUUCGUCUGAAUUCG C A UU^ CG - ACUGU . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Snu-Mir-216-P1_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UAAUAUCAGCUGGUAAUUCAGAG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Snu-Mir-216-P1_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- CUGGAUGCUGCCUGAUAUUUUGA -60
Get sequence
|






