| MirGeneDB ID | Sto-Mir-15-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-15 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Sto-Mir-15-P1a Sto-Mir-15-P1b Sto-Mir-15-P1d Sto-Mir-15-P2a Sto-Mir-15-P2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-15-P2b Ami-Mir-15-P2b Bta-Mir-15-P2b Cfa-Mir-15-P2b Cin-Mir-15-P2 Cja-Mir-15-P2b Cli-Mir-15-P2b Cmi-Mir-15-P2b Cpi-Mir-15-P2b Cpo-Mir-15-P2b Dno-Mir-15-P2b Dre-Mir-15-P2b Eca-Mir-15-P2b Ete-Mir-15-P2b Gga-Mir-15-P2b Gja-Mir-15-P2b Gmo-Mir-15-P2b Hsa-Mir-15-P2b Laf-Mir-15-P2b Lch-Mir-15-P2b Loc-Mir-15-P2b Mal-Mir-15-P2b Mdo-Mir-15-P2b Mml-Mir-15-P2b Mmr-Mir-15-P2b Mmu-Mir-15-P2b Mun-Mir-15-P2b Neu-Mir-15-P2b Oan-Mir-15-P2b Ocu-Mir-15-P2b Pab-Mir-15-P2b Pbv-Mir-15-P2b Rno-Mir-15-P2b Sha-Mir-15-P2b Spt-Mir-15-P2b Tgu-Mir-15-P2b Tni-Mir-15-P2b Xla-Mir-15-P2b1 Xla-Mir-15-P2b2 Xtr-Mir-15-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Olfactores | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01000434.1: 79754-79810 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-15-P2b) |
Mir-15-P2b
BFAA01000434.1: 79754-79810 [-]
Mir-15-P1b BFAA01000434.1: 79932-79992 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AGCAGCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GACCUGUUAAUGAAAAUGCCAGUUACACUUUAGCAGCACGUAAAUAUUGGCGUGGCAAUAAUCGCCAAUAUUACUUGUGCUGCUGCAGCGUGACAUGGUUUUAUCACCCGCCAGAUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GACCUGUUAAUGAAAAU- - A U UA-| UGGC GCCA GUUAC CU UAGCAGCACG AAUAUUGGCG A UGGU CAGUG GA GUCGUCGUGU UUAUAACCGC A CUAGACCGCCCACUAUUU A C C UCA^ UAAU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-15-P2b_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UAGCAGCACGUAAAUAUUGGCG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-15-P2b_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
34- CCAAUAUUACUUGUGCUGCUGCA -57
Get sequence
|






