| MirGeneDB ID | Sto-Mir-19-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-19 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Sto-Mir-19-P1a-v1 Sto-Mir-19-P1c Sto-Mir-19-P2a Sto-Mir-19-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-19-P2c Ami-Mir-19-P2c Bta-Mir-19-P2c Cfa-Mir-19-P2c Cja-Mir-19-P2c Cli-Mir-19-P2c Cmi-Mir-19-P2c Cpi-Mir-19-P2c Cpo-Mir-19-P2c Dno-Mir-19-P2c Dre-Mir-19-P2c Eca-Mir-19-P2c Ete-Mir-19-P2c Gga-Mir-19-P2c Gja-Mir-19-P2c Gmo-Mir-19-P2c Hsa-Mir-19-P2c Laf-Mir-19-P2c Lch-Mir-19-P2c Mdo-Mir-19-P2c Mml-Mir-19-P2c Mmr-Mir-19-P2c Mmu-Mir-19-P2c Mun-Mir-19-P2c Neu-Mir-19-P2c Oan-Mir-19-P2c Ocu-Mir-19-P2c Pab-Mir-19-P2c Pbv-Mir-19-P2c Rno-Mir-19-P2c Sha-Mir-19-P2c Spt-Mir-19-P2c Tgu-Mir-19-P2c Xla-Mir-19-P2c3 Xla-Mir-19-P2c4 Xtr-Mir-19-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01013767.1: 5089-5150 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-19-P2c) |
Mir-17-P1c
BFAA01013767.1: 3033-3091 [+]
Mir-17-P2c BFAA01013767.1: 3215-3279 [+] Mir-19-P1c BFAA01013767.1: 4765-4822 [+] Mir-17-P4c BFAA01013767.1: 4955-5015 [+] Mir-19-P2c BFAA01013767.1: 5089-5150 [+] Mir-92-P1c BFAA01013767.1: 5248-5309 [+] Mir-92-P2c BFAA01013767.1: 5411-5474 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GUGCAAA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GGAAAUCUUCAUGAGGUACUGUUAACAGUUAGUUUUGCAGGUUUGCAUUCAGCUGAUAUGUGCUGAUGCUGUGCAAAUCCAUGCAAAACUGACAGUAGCAGUGGUUUCUAGAGAAUUGAAUGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GGAAAUCUUCAUGAGGU--- ACA - -| UU UGAUAU ACUGUUA GUUAGUUUUGCA GG UUUGCA CAGC G UGACGAU CAGUCAAAACGU CC AAACGU GUCG U GUAAGUUAAGAGAUCUUUGG GA- A U^ -- UAGUCG 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-19-P2c_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGUUUUGCAGGUUUGCAUUCAGC -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-19-P2c_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
39- UGUGCAAAUCCAUGCAAAACUGA -62
Get sequence
|






