| MirGeneDB ID | Sto-Mir-24-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-24 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Sto-Mir-24-P1 Sto-Mir-24-P2 Sto-Mir-24-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-24-P3 Ami-Mir-24-P3 Bta-Mir-24-P3 Cfa-Mir-24-P3 Cja-Mir-24-P3 Cmi-Mir-24-P3 Cpi-Mir-24-P3 Cpo-Mir-24-P3 Dno-Mir-24-P3 Dre-Mir-24-P3 Eca-Mir-24-P3 Ete-Mir-24-P3 Gga-Mir-24-P3 Gja-Mir-24-P3 Gmo-Mir-24-P3 Hsa-Mir-24-P3 Laf-Mir-24-P3 Lch-Mir-24-P3 Loc-Mir-24-P3 Mdo-Mir-24-P3 Mml-Mir-24-P3 Mmr-Mir-24-P3 Mmu-Mir-24-P3 Mun-Mir-24-P3a Mun-Mir-24-P3b Neu-Mir-24-P3 Oan-Mir-24-P3 Ocu-Mir-24-P3 Pab-Mir-24-P3 Pbv-Mir-24-P3 Rno-Mir-24-P3 Sha-Mir-24-P3 Tgu-Mir-24-P3 Tni-Mir-24-P3 Xla-Mir-24-P3c Xla-Mir-24-P3d Xtr-Mir-24-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01001728.1: 147134-147193 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-24-P3) |
Mir-24-P3
BFAA01001728.1: 147134-147193 [-]
Mir-27-P3a BFAA01001728.1: 154600-154664 [-] Mir-23-P3 BFAA01001728.1: 158875-158934 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GGCUCAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AACAACUGGAAGAAGCGGGCUCAAUCUUCUGUGCCUACUGAGCUGAUAACAGUUGAUGUAGCCUGCACUGGCUCAGUUCAGCAGGAACAGAAGUUGUUCCUCUUUGACUACCUGAAAUUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AACAACUGGAAGAAGCG---| CU U G A UAA UGAUGU GG CAA CUUCUGU CCU CUGAGCUGA CAGU \ CC GUU GAAGACA GGA GACUUGACU GUCA A CUUAAAGUCCAUCAGUUUCU^ UU - A C CG- CGUCCG . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Drosha cut +1 on the 5p arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-24-P3_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GUGCCUACUGAGCUGAUAACAGU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-24-P3_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence
|






