| MirGeneDB ID | Sto-Mir-30-P2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-30 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Sto-Mir-30-P1a Sto-Mir-30-P1d3 Sto-Mir-30-P1d4 Sto-Mir-30-P2a Sto-Mir-30-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-30-P2d Ami-Mir-30-P2d Bta-Mir-30-P2d Cfa-Mir-30-P2d Cja-Mir-30-P2d Cli-Mir-30-P2d Cmi-Mir-30-P2d Cpi-Mir-30-P2d Cpo-Mir-30-P2d Dno-Mir-30-P2d Dre-Mir-30-P2d Eca-Mir-30-P2d Ete-Mir-30-P2d Gga-Mir-30-P2d Gja-Mir-30-P2d Gmo-Mir-30-P2d Hsa-Mir-30-P2d Laf-Mir-30-P2d Lch-Mir-30-P2d Loc-Mir-30-P2d Mal-Mir-30-P2d Mdo-Mir-30-P2d Mml-Mir-30-P2d Mmr-Mir-30-P2d Mmu-Mir-30-P2d Mun-Mir-30-P2d Neu-Mir-30-P2d Oan-Mir-30-P2d Ocu-Mir-30-P2d Pab-Mir-30-P2d Pbv-Mir-30-P2d Rno-Mir-30-P2d Sha-Mir-30-P2d Spt-Mir-30-P2d Tgu-Mir-30-P2d Tni-Mir-30-P2d Xla-Mir-30-P2d1 Xla-Mir-30-P2d2 Xtr-Mir-30-P2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01005240.1: 117707-117766 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-30-P2d) |
Mir-30-P2d
BFAA01005240.1: 117707-117766 [-]
Mir-30-P1d4 BFAA01005240.1: 133181-133243 [-] Mir-30-P1d3 BFAA01005240.1: 134438-134501 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GUAAACA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUCACAGUCCCAACACUGUGCUCUAGUGUGUGUAAACAUCCUACACUCUCAGCUGUGGUCUGACUGAGCUGGGAGAGGGAUGUUUGCUCAUUCUGACACAGACUGAGCAGCAACAAGUCAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AUCACAGUCCCAACACU----| C U U U ACA GUGGU GUG UC AG GUG GUAAACAUCCU CUCUCAGCU C CAC AG UC UAC CGUUUGUAGGG GAGGGUCGA U ACUGAACAACGACGAGUCAGA^ - - U U A-- GUCAG . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-30-P2d_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGUAAACAUCCUACACUCUCAGCU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-30-P2d_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- CUGGGAGAGGGAUGUUUGCUCA -60
Get sequence
|






