| MirGeneDB ID | Agr-Mir-92-o112 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | West Indian fuzzy chiton (Acanthopleura granulata ) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Agr-Mir-92-o109 Agr-Mir-92-o110 Agr-Mir-92-o111 Agr-Mir-92-o113 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | A. granulata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_016165875.1_ASM1616587v1_Acanthopleura_granulata) |
JABBOT010000006.1: 4002146-4002204 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-o112) |
Mir-92-o113
JABBOT010000006.1: 4001698-4001754 [-]
Ensembl
Mir-92-o112 JABBOT010000006.1: 4002146-4002204 [-] Ensembl Mir-92-o111 JABBOT010000006.1: 4002356-4002416 [-] Ensembl Mir-92-o110 JABBOT010000006.1: 4003172-4003231 [-] Ensembl Mir-92-o109 JABBOT010000006.1: 4011002-4011063 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUUCUUUCGGGUUCUGUCCAGAGUUGUGGCGGGCGAGACAUGUGCAACUUGCUGAGCUCUGAAGACAAAUUGCACUUGUCCCGGCCUGCCUCUGCUCUGGAAAUAUCAGUCGUGUGAUUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AUUCUUUCGGGUUCUGU-- UGU -| A U C CUGAGC CCAGAGU GGCGGG CG GACA GUGCAA UUG U GGUCUCG CCGUCC GC CUGU CACGUU AAC C UUAGUGUGCUGACUAUAAA UCU G^ C U A AGAAGU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Agr-Mir-92-o112_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGGCGAGACAUGUGCAACUUG -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Agr-Mir-92-o112_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- AAUUGCACUUGUCCCGGCCUGC -59
Get sequence
|






