| MirGeneDB ID | Cja-Mir-193-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-193 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | White-tufted-ear marmoset (Callithrix jacchus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cja-Mir-193-P1a Cja-Mir-193-P1b Cja-Mir-193-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Ami-Mir-193-P2a Bge-Mir-193-P2 Bta-Mir-193-P2a Cbr-Mir-193-P2-v1 Cel-Mir-193-P2-v1 Cfa-Mir-193-P2a Cli-Mir-193-P2a Cmi-Mir-193-P2a Cpi-Mir-193-P2a Cpo-Mir-193-P2a Cte-Mir-193-P2 Dgr-Mir-193-P2 Dlo-Mir-193-P2 Dno-Mir-193-P2a Dre-Mir-193-P2a Ebu-Mir-193-P2 Eca-Mir-193-P2a Ete-Mir-193-P2a Gga-Mir-193-P2a Hme-Mir-193-P2 Hru-Mir-193-P2 Hsa-Mir-193-P2a Laf-Mir-193-P2a Lch-Mir-193-P2a Lgi-Mir-193-P2 Llo-Mir-193-P2-v1 Loc-Mir-193-P2a Mdo-Mir-193-P2a Mgi-Mir-193-P2 Mml-Mir-193-P2a Mmr-Mir-193-P2a Mmu-Mir-193-P2a Mun-Mir-193-P2a Neu-Mir-193-P2a Oan-Mir-193-P2a Ocu-Mir-193-P2a Pab-Mir-193-P2a Pau-Mir-193-P2 Pbv-Mir-193-P2a Pdu-Mir-193-P2 Pfl-Mir-193-P2 Pma-Mir-193-P2 Pmi-Mir-193-P2 Pve-Mir-193-P2 Rno-Mir-193-P2a Rph-Mir-193-P2 Sha-Mir-193-P2a Sko-Mir-193-P2 Snu-Mir-193-P2 Spt-Mir-193-P2a Spu-Mir-193-P2 Sro-Mir-193-P2 Sto-Mir-193-P2a Tca-Mir-193-P2 Tgu-Mir-193-P2a Xbo-Mir-193-P2 Xla-Mir-193-P2a3 Xla-Mir-193-P2a4 Xtr-Mir-193-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_011100555.2_mCalJa1.2.pat.X_genomic) |
CM021926.1: 12472740-12472800 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-193-P2a) |
Mir-193-P2a
CM021926.1: 12472740-12472800 [-]
UCSC
Ensembl
Mir-193-P1a CM021926.1: 12478453-12478511 [-] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAUGCCC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GCCAGCUGGUUCAUUACCGCAGGGAAAAUGAGGGACUUUUGGGGGCAGAUGUGUUUCCAUUCCACUAUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCAGUAUUCCUCGGGGGUGCCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GCCAGCUGGUUCAUUACC--| AA AC GA UUUCCAU GCAGGG AAUGAGGG UUUUGGGGGCA UGUG \ CGUUCU UUAUUCCU AAAAUCCCCGU AUAC U UCCGUGGGGGCUCCUUAUGA^ CG A- A- UAUCACC . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | Although there is a templated T at the 3' end of the 3p arm, the post-transcriptional addition of a terminal 3' U is supported by the CAGE data from de Rie et al. (2017). All other osteichthyians are treated accordingly. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cja-Mir-193-P2a_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGGACUUUUGGGGGCAGAUGUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cja-Mir-193-P2a_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- UAAUGCCCCUAAAAAUCCUUA -61
Get sequence
|






