| MirGeneDB ID | Ete-Mir-145 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-145 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Lesser hedgehog tenrec (Echinops telfairi) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-145 Ami-Mir-145 Bta-Mir-145 Cfa-Mir-145 Cja-Mir-145 Cli-Mir-145 Cmi-Mir-145 Cpi-Mir-145 Cpo-Mir-145 Dno-Mir-145 Dre-Mir-145 Ebu-Mir-145 Eca-Mir-145 Gga-Mir-145 Gja-Mir-145 Gmo-Mir-145 Hsa-Mir-145 Laf-Mir-145 Lch-Mir-145 Loc-Mir-145 Mal-Mir-145 Mdo-Mir-145 Mml-Mir-145 Mmr-Mir-145 Mmu-Mir-145 Mun-Mir-145 Neu-Mir-145 Oan-Mir-145 Ocu-Mir-145 Pab-Mir-145 Pbv-Mir-145 Pma-Mir-145 Rno-Mir-145 Sha-Mir-145 Spt-Mir-145 Sto-Mir-145 Tgu-Mir-145 Xla-Mir-145-P1 Xla-Mir-145-P2 Xtr-Mir-145 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (echTel2) |
JH980294: 39063870-39063929 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-145) |
Mir-143
JH980294: 39062492-39062546 [+]
UCSC
Mir-145 JH980294: 39063870-39063929 [+] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UCCAGUU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UGAAGGCCACUCUCCCACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUUUAACAGCUGGAUCUGCCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UGAAGGCCACUCUCCCA--| U U C UC U C UAGAUG CC UG CCUCA GG CAGU UU CCAGGAAUCCCU \ GG AC GGAGU UC GUCA AA GGUCCUUAGGGG C CCGUCUAGGUCGACAAUUU^ U U - UU U A UAGAAU . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Dicer cut -2 on both arms. Although there is a templated T at the 3' end of the 3p arm, this transcript is annotated as a Group 2 miRNA given the CAGE data in human and the 5' starting cut of 3' offset reads in various vertebrate taxa. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ete-Mir-145_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GUCCAGUUUUCCCAGGAAUCCCU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ete-Mir-145_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- GGAUUCCUGGAAAUACUGUUCU -60
Get sequence
|






