| MirGeneDB ID | Pbv-Mir-145 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-145 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Burmese python (Python bivittatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pbv-mir-145 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-145 Ami-Mir-145 Bta-Mir-145 Cfa-Mir-145 Cja-Mir-145 Cli-Mir-145 Cmi-Mir-145 Cpi-Mir-145 Cpo-Mir-145 Dno-Mir-145 Dre-Mir-145 Ebu-Mir-145 Eca-Mir-145 Ete-Mir-145 Gga-Mir-145 Gja-Mir-145 Gmo-Mir-145 Hsa-Mir-145 Laf-Mir-145 Lch-Mir-145 Loc-Mir-145 Mal-Mir-145 Mdo-Mir-145 Mml-Mir-145 Mmr-Mir-145 Mmu-Mir-145 Mun-Mir-145 Neu-Mir-145 Oan-Mir-145 Ocu-Mir-145 Pab-Mir-145 Pma-Mir-145 Rno-Mir-145 Sha-Mir-145 Spt-Mir-145 Sto-Mir-145 Tgu-Mir-145 Xla-Mir-145-P1 Xla-Mir-145-P2 Xtr-Mir-145 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000186305.2_Python_molurus_bivittatus) |
KE953037.1: 158363-158422 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-145) |
Mir-145
KE953037.1: 158363-158422 [-]
Mir-143 KE953037.1: 158991-159045 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UCCAGUU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUCUGAGCCUAAUCUCACUAUGUCCUCGGGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAAGGGGAUUCCUGGAAAUACUGUUCUUGGGGUCAUGGCUCAGCAACUGAAGACAAUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AUCUGAGCCUAAUCUCA--| U UC U C UAGAUG CUAUG CCUCGGGG CAGU UU CCAGGAAUCCCU \ GGUAC GGGGUUCU GUCA AA GGUCCUUAGGGG C UAACAGAAGUCAACGACUC^ U U- U A AAGAAU . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There are Dicer cuts -1 and -2 on the 3p arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pbv-Mir-145_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038959 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GUCCAGUUUUCCCAGGAAUCCCU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pbv-Mir-145_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038960 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- GGAUUCCUGGAAAUACUGUUCU -60
Get sequence
|






