| MirGeneDB ID | Gja-Mir-17-P4c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-17 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Schlegels Japanese gecko (Gekko japonicus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Gja-Mir-17-P1a Gja-Mir-17-P1c Gja-Mir-17-P2a Gja-Mir-17-P2c Gja-Mir-17-P4a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-17-P4c Ami-Mir-17-P4c Bta-Mir-17-P4c Cfa-Mir-17-P4c Cja-Mir-17-P4c Cli-Mir-17-P4c Cmi-Mir-17-P4c Cpi-Mir-17-P4c Cpo-Mir-17-P4c Dno-Mir-17-P4c Dre-Mir-17-P4c Eca-Mir-17-P4c Ete-Mir-17-P4c Gga-Mir-17-P4c Gmo-Mir-17-P4c Hsa-Mir-17-P4c Laf-Mir-17-P4c Lch-Mir-17-P4c Loc-Mir-17-P4c Mal-Mir-17-P4c Mdo-Mir-17-P4c Mml-Mir-17-P4c Mmr-Mir-17-P4c Mmu-Mir-17-P4c Neu-Mir-17-P4c Oan-Mir-17-P4c Ocu-Mir-17-P4c Pab-Mir-17-P4c Pbv-Mir-17-P4c Rno-Mir-17-P4c Sha-Mir-17-P4c Spt-Mir-17-P4c Sto-Mir-17-P4c Tgu-Mir-17-P4c Xla-Mir-17-P4c3 Xla-Mir-17-P4c4 Xtr-Mir-17-P4c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_001447785.1_Gekko_japonicus) |
NW_015169856.1: 119534-119595 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-17-P4c) |
Mir-92-P2c
NW_015169856.1: 119070-119134 [-]
Mir-92-P1c NW_015169856.1: 119224-119288 [-] Mir-19-P2c NW_015169856.1: 119403-119463 [-] Mir-17-P4c NW_015169856.1: 119534-119595 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAAGUGC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UUCGUCAUACUUGCCUUGUCCUUGCAGUAGCAAAGUGCUCAUAGUGCAGGUAGUUGUUCACCCAAAUCUACUGUAAUAUGGGCACUUACAGUACUGCUGGAUCCAAAAGCACCUUGCUGUCCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 UUCGUCAUACUUGCCUU---| UU GCA- G G UUGUUC GUCC GCAGUA AAGUGCUCAUA UGCAG UAG A UAGG CGUCAU UUCACGGGUAU AUGUC AUC C CCUGUCGUUCCACGAAAACC^ U- GACA A - UAAACC 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Dicer cut +2 on the 3p arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Gja-Mir-17-P4c_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CAAAGUGCUCAUAGUGCAGGUAG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Gja-Mir-17-P4c_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
39- ACUGUAAUAUGGGCACUUACAGU -62
Get sequence
|






