| MirGeneDB ID | Gja-Mir-17-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-17 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Schlegels Japanese gecko (Gekko japonicus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Gja-Mir-17-P1a Gja-Mir-17-P1c Gja-Mir-17-P2c Gja-Mir-17-P4a Gja-Mir-17-P4c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-17-P2a Ami-Mir-17-P2a Bta-Mir-17-P2a Cfa-Mir-17-P2a Cja-Mir-17-P2a Cli-Mir-17-P2a Cmi-Mir-17-P2a Cpi-Mir-17-P2a Cpo-Mir-17-P2a Dno-Mir-17-P2a Dre-Mir-17-P2a1 Dre-Mir-17-P2a2 Eca-Mir-17-P2a Ete-Mir-17-P2a Gga-Mir-17-P2a Gmo-Mir-17-P2a1 Gmo-Mir-17-P2a2 Hsa-Mir-17-P2a Laf-Mir-17-P2a Lch-Mir-17-P2a Loc-Mir-17-P2a Mal-Mir-17-P2a2a Mal-Mir-17-P2a2b Mdo-Mir-17-P2a Mml-Mir-17-P2a Mmr-Mir-17-P2a Mmu-Mir-17-P2a Mun-Mir-17-P2a Neu-Mir-17-P2a Oan-Mir-17-P2a Ocu-Mir-17-P2a Pab-Mir-17-P2a Pbv-Mir-17-P2a Rno-Mir-17-P2a Sha-Mir-17-P2a Spt-Mir-17-P2a Sto-Mir-17-P2a Tgu-Mir-17-P2a Tni-Mir-17-P2a1 Tni-Mir-17-P2a2 Xla-Mir-17-P2a3 Xla-Mir-17-P2a4 Xtr-Mir-17-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_001447785.1_Gekko_japonicus) |
NW_015159750.1: 119955-120019 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-17-P2a) |
Mir-92-P1a
NW_015159750.1: 119406-119466 [-]
Mir-19-P2a NW_015159750.1: 119520-119580 [-] Mir-17-P4a NW_015159750.1: 119664-119722 [-] Mir-19-P1a NW_015159750.1: 119825-119882 [-] Mir-17-P2a NW_015159750.1: 119955-120019 [-] Mir-17-P1a NW_015159750.1: 120099-120159 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAGGUGC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CGUAGUGUGGUGUUUUAAUGCUUUUUGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGACUAGCAUCUACUGCCCUAAGUGCUCCUUCUGGCAUAAGAAGUUGUAUUUUCAUCCAGUCACUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CGUAGUGUGGUGUUUUAAU-- U --| U UC U A UGAAGUA GCUUUUUGU CUA AGG GCA UAG GCAG UAG G UGAAGAAUA GGU UCC CGU AUC CGUC AUC A CUCACUGACCUACUUUUAUGU C CU^ U GA C - UACGAUC 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Gja-Mir-17-P2a_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UAAGGUGCAUCUAGUGCAGAUAG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Gja-Mir-17-P2a_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
41- ACUGCCCUAAGUGCUCCUUCUGGC -65
Get sequence
|






