| MirGeneDB ID | Lan-Mir-92-o79b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Lingula (Lingula anatina) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Lan-Mir-92-o79a Lan-Mir-92-o80a Lan-Mir-92-o80b Lan-Mir-92-o81 Lan-Mir-92-o82 Lan-Mir-92-o83 Lan-Mir-92-o84 Lan-Mir-92-o85 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | L. anatina | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (LinAna_1.0) |
LFEI01000276: 124834-124893 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-o79b) |
Mir-92-o82
LFEI01000276: 118697-118751 [+]
Ensembl
Mir-92-o81 LFEI01000276: 121194-121254 [+] Ensembl Mir-92-o79a LFEI01000276: 121524-121583 [+] Ensembl Mir-92-o80a LFEI01000276: 122217-122275 [+] Ensembl Mir-92-o79b LFEI01000276: 124834-124893 [+] Ensembl Mir-92-o80b LFEI01000276: 125520-125578 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUUUAAGUAAAAGAGUGUGUUGUACGUGACAGGCGGAACGAGAGCAACUUUGAUAACUUUUGUCCCCAAAUUGCACUCGUCCCGGCCUGCCGCGCUCGGCAUUCCGACGUCUAGCUGCACGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AUUUAAGUAAAAGAGUG-- UA A -| A A C AUAACU UGUUG CGUG CAGG CGG ACGAG GCAA UUUG U ACGGC GCGC GUCC GCC UGCUC CGUU AAAC U CACGUCGAUCUGCAGCCUU UC C G^ C A - CCCUGU . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Lan-Mir-92-o79b_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGCGGAACGAGAGCAACUUUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Lan-Mir-92-o79b_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- AAUUGCACUCGUCCCGGCCUGC -60
Get sequence
|






