| MirGeneDB ID | Lgi-Mir-92-o29 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Owl limpet (Lottia gigantea) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | lgi-mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Lgi-Mir-92-o28 Lgi-Mir-92-o30 Lgi-Mir-92-o31 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | L. gigantea | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Lotgi1) |
LOTGIsca_47: 43373-43430 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-o29-v1) |
Mir-92-o31
LOTGIsca_47: 43039-43096 [-]
Ensembl
Mir-92-o30 LOTGIsca_47: 43249-43304 [-] Ensembl Mir-92-o29-v1 LOTGIsca_47: 43373-43430 [-] Ensembl Mir-92-o29-v2 LOTGIsca_47: 43373-43430 [-] Ensembl Mir-92-o28 LOTGIsca_47: 46552-46607 [-] Ensembl Mir-190-v1 LOTGIsca_47: 52951-53013 [-] Ensembl Mir-190-v2 LOTGIsca_47: 52952-53012 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Variant | Lgi-Mir-92-o29-v1 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UUUAUUUCAUAAUGAAGAAAGAUGAGUUGCAGGUCGUGAUAUUUGCAAUAUGGAGAAGAAUAAUCAAAUUGCACUUGUCCCGGCCUGCUGCAAAGUCUUCACCUCAACUAAAUAGUAUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UUUAUUUCAUAAUGAAGA- GA-| U U UU A GAGAA AAGAU GU GCAGGUCG GAUA UGCAAU UG G UUCUG CG CGUCCGGC CUGU ACGUUA AC A UAUGAUAAAUCAACUCCAC AAA^ U C UC A UAAUA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Lgi-Mir-92-o29-v1_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGUCGUGAUAUUUGCAAUAUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Lgi-Mir-92-o29-v1_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0009574 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
36- AAUUGCACUUGUCCCGGCCUGC -58
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Variant | Lgi-Mir-92-o29-v2 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UUGCACU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UUUAUUUCAUAAUGAAGAAAGAUGAGUUGCAGGUCGUGAUAUUUGCAAUAUGGAGAAGAAUAAUCAAAUUGCACUUGUCCCGGCCUGCUGCAAAGUCUUCACCUCAACUAAAUAGUAUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UUUAUUUCAUAAUGAAGA- GA-| U U UU A GAGAA AAGAU GU GCAGGUCG GAUA UGCAAU UG G UUCUG CG CGUCCGGC CUGU ACGUUA AC A UAUGAUAAAUCAACUCCAC AAA^ U C UC A UAAUA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Lgi-Mir-92-o29-v2_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGUCGUGAUAUUUGCAAUAUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Lgi-Mir-92-o29-v2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0009574 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- AUUGCACUUGUCCCGGCCUGC -58
Get sequence
|






