| MirGeneDB ID | Ofu-Mir-92-o146 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Tubeworm (Owenia fusiformis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ofu-Mir-92-o141 Ofu-Mir-92-o142 Ofu-Mir-92-o143 Ofu-Mir-92-o144 Ofu-Mir-92-o145 Ofu-Mir-92-o147 Ofu-Mir-92-o148 Ofu-Mir-92-o149 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | O. fusiformis | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_903813345.2_Owenia) |
CAIIXF020000007.1: 16092897-16092953 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-o146) |
Mir-92-o146
CAIIXF020000007.1: 16092897-16092953 [-]
Mir-92-o145 CAIIXF020000007.1: 16093752-16093810 [-] Mir-92-o144 CAIIXF020000007.1: 16094086-16094141 [-] Mir-92-o143 CAIIXF020000007.1: 16094923-16094980 [-] Mir-92-o142 CAIIXF020000007.1: 16098734-16098792 [-] Mir-92-o141 CAIIXF020000007.1: 16102466-16102523 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GUCGUUAUGGUGACACAAAAGGGGUACUGUCGGUCGUGACUUUUGCAAUAUGUUGUUGUGAACCAGAUUGCACUUGUCCCGGCCUGCUUUAGUCCGAAUAUUCUACAAUAGGUGUCCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GUCGUUAUGGUGACACAAAA--| G CU C U UUU A UUGUU GGG UA GU GGUCG GAC UGCAAU UG \ CCU AU CG CCGGC CUG ACGUUA AC G CCUGUGGAUAACAUCUUAUAAG^ G UU U C UUC G CAAGU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ofu-Mir-92-o146_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CGGUCGUGACUUUUGCAAUAUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ofu-Mir-92-o146_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- GAUUGCACUUGUCCCGGCCUGC -57
Get sequence
|






