| MirGeneDB ID | Pmi-Mir-92-o22 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Bat starfish (Patiria miniata) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pmi-mir-92b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pmi-Mir-92-o21 Pmi-Mir-92-o23 Pmi-Mir-92-o24 Pmi-Mir-92-o25 Pmi-Mir-92-o26 Pmi-Mir-92-o27 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 Tur-Mir-92-P22 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | P. miniata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Pmin1) |
JH772232.1: 12795-12854 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-o22) |
Mir-92-o25
JH772232.1: 9421-9483 [-]
Mir-92-o24 JH772232.1: 11031-11096 [-] Mir-92-o23 JH772232.1: 11838-11900 [-] Mir-92-o22 JH772232.1: 12795-12854 [-] Mir-92-o21 JH772232.1: 21466-21523 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AGUACUUUGCCUUCUACUGUGUUGCCUGGUAGGUCUUGACGAGCGCCAUGUUGUCAUCUUGAGGGUAAUAUUGCACUCGUCCCGGCCUGCUGGUCAGCUCAACUACCUUGGAGGCAAAUGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AGUACUUUGCCUUCUAC--| U C UG UU C C GUCAUC UG GUUG C GUAGGUC GACGAG GC AUGUU U AC CGAC G CGUCCGG CUGCUC CG UAUAA U GUAAACGGAGGUUCCAUCA^ U U GU CC A U UGGGAG . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pmi-Mir-92-o22_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGUCUUGACGAGCGCCAUGUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pmi-Mir-92-o22_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0032152 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UAUUGCACUCGUCCCGGCCUGC -60
Get sequence
|






