| MirGeneDB ID | Sko-Mir-92-o12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Saccoglossus (Saccoglossus kowalevskii) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | sko-mir-92c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Sko-Mir-92-o9 Sko-Mir-92-o10 Sko-Mir-92-o11 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Asu-Mir-92 Cel-Mir-92 Csc-Mir-92-P12 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | S. kowalevskii | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Skow_1.1) |
NW_003140819.1: 40783-40840 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-o12) |
Mir-92-o12
NW_003140819.1: 40783-40840 [-]
Mir-92-o11 NW_003140819.1: 41465-41525 [-] Mir-92-o10 NW_003140819.1: 42177-42232 [-] Mir-92-o9 NW_003140819.1: 55331-55388 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CUGGUUACCAUGGAUACUGGUUGGCCAUGGAGGUUAGGACUUUUGCAAUAUUUUGAUAUUAUUUAAUAUUGCACUCGUCCCGGCCUGUAUGUUUCAACUAACUUACAUCGUGGACCAAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CUGGUUACCAUGGAUAC- C-| G UA UUU UUGAU UGGUUGG CAUG AGGU GGAC UGCAAUAUU A AUCAACU GUAU UCCG CCUG ACGUUAUAA U AACCAGGUGCUACAUUCA UU^ G GC CUC UUUAU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sko-Mir-92-o12_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGUUAGGACUUUUGCAAUAUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sko-Mir-92-o12_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0009621 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
36- UAUUGCACUCGUCCCGGCCUGU -58
Get sequence
|






