| MirGeneDB ID | Sto-Mir-181-P1a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-181 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Sto-Mir-181-P1b Sto-Mir-181-P1c Sto-Mir-181-P2a Sto-Mir-181-P2b Sto-Mir-181-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-181-P1a Ami-Mir-181-P1a Bta-Mir-181-P1a Cfa-Mir-181-P1a Cja-Mir-181-P1a Cli-Mir-181-P1a Cmi-Mir-181-P1a Cpi-Mir-181-P1a Cpo-Mir-181-P1a Dno-Mir-181-P1a Dre-Mir-181-P1a1 Dre-Mir-181-P1a2 Eca-Mir-181-P1a Ete-Mir-181-P1a Gga-Mir-181-P1a Gja-Mir-181-P1a Gmo-Mir-181-P1a1 Hsa-Mir-181-P1a Laf-Mir-181-P1a Lch-Mir-181-P1a Loc-Mir-181-P1a Mal-Mir-181-P1a1 Mdo-Mir-181-P1a Mml-Mir-181-P1a Mmr-Mir-181-P1a Mmu-Mir-181-P1a Mun-Mir-181-P1a Neu-Mir-181-P1a Oan-Mir-181-P1a Ocu-Mir-181-P1a Pab-Mir-181-P1a Rno-Mir-181-P1a Sha-Mir-181-P1a Spt-Mir-181-P1a Tgu-Mir-181-P1a Tni-Mir-181-P1a1 Xla-Mir-181-P1a3 Xla-Mir-181-P1a4 Xtr-Mir-181-P1a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01003042.1: 25002-25063 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-181-P1a) |
Mir-181-P2a
BFAA01003042.1: 24795-24855 [-]
Mir-181-P1a BFAA01003042.1: 25002-25063 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | ACAUUCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUUCUAAUGCAUUUGCUGGUGGUUUCAGGGAACAUUCAACGCUGUCGGUGAGUUUGAUGCUAUUGGAGAAACCAUCGACCGUUGAUUGUACCUUGUAGCUAACCUCCUCCACCUGCCUUUGGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AUUCUAAUGCAUUUGCU- -| U A U CU A UUGAUGCU GG UGGUU CAGGG ACA UCAACG GUCGGUG GU \ CC AUCGA GUUCC UGU AGUUGC CAGCUAC CA A GGUUUCCGUCCACCUCCU A^ U A U -- - AAGAGGUU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-181-P1a_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AACAUUCAACGCUGUCGGUGAGU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-181-P1a_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- ACCAUCGACCGUUGAUUGUACC -62
Get sequence
|






