| MirGeneDB ID | Sto-Mir-181-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-181 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Sto-Mir-181-P1a Sto-Mir-181-P1b Sto-Mir-181-P2a Sto-Mir-181-P2b Sto-Mir-181-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-181-P1c Ami-Mir-181-P1c Bta-Mir-181-P1c Cfa-Mir-181-P1c Cja-Mir-181-P1c Cmi-Mir-181-P1c Cpi-Mir-181-P1c Cpo-Mir-181-P1c Dno-Mir-181-P1c Dre-Mir-181-P1c1 Dre-Mir-181-P1c2 Eca-Mir-181-P1c Ete-Mir-181-P1c Gja-Mir-181-P1c Gmo-Mir-181-P1c1 Gmo-Mir-181-P1c2 Hsa-Mir-181-P1c Laf-Mir-181-P1c Lch-Mir-181-P1c Loc-Mir-181-P1c Mal-Mir-181-P1c1 Mal-Mir-181-P1c2 Mdo-Mir-181-P1c Mml-Mir-181-P1c Mmr-Mir-181-P1c Mmu-Mir-181-P1c Mun-Mir-181-P1c Neu-Mir-181-P1c Oan-Mir-181-P1c Ocu-Mir-181-P1c Pab-Mir-181-P1c Pbv-Mir-181-P1c Rno-Mir-181-P1c Sha-Mir-181-P1c Spt-Mir-181-P1c Tni-Mir-181-P1c1 Tni-Mir-181-P1c2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01009266.1: 65677-65738 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-181-P1c) |
Mir-181-P1c
BFAA01009266.1: 65677-65738 [+]
Mir-181-P2c BFAA01009266.1: 70250-70309 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | ACAUUCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CUCCGCUGCGGAUCAGUGACGACCUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGGAAGUAUAAAUGAAACCAUUGACCGUUGACUGUACCCUGCGGCCGGGAUGGUAACUGCUGUGGAAGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CUCCGCUGCGGAUCAGUGA--| A U UGA U CU A UUGGAAGU CG CC CAG ACA UCAACG GUCGGUG GU \ GC GG GUC UGU AGUUGC CAGUUAC CA A GAAGGUGUCGUCAAUGGUAGG^ C C CCA C -- - AAGUAAAU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-181-P1c_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AACAUUCAACGCUGUCGGUGAGU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-181-P1c_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- ACCAUUGACCGUUGACUGUACC -62
Get sequence
|






