| MirGeneDB ID | Bla-Mir-92-o3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | European lancelet (Branchiostoma lanceolatum) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Bla-Mir-92-o1 Bla-Mir-92-o2 Bla-Mir-92-o4 Bla-Mir-92-o5 Bla-Mir-92-o6 Bla-Mir-92-o7 Bla-Mir-92-o8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-92-P3 Aga-Mir-92-P3 Asu-Mir-92 Bfl-Mir-92-o3 Bge-Mir-92-P3 Cel-Mir-92 Dan-Mir-92-P3 Dlo-Mir-92-P3 Dma-Mir-92-P3 Dme-Mir-92-P3 Dmo-Mir-92-P3 Dpu-Mir-92-P3 Dsi-Mir-92-P3 Dya-Mir-92-P3 Esc-Mir-92 Gpa-Mir-92-P3 Gsp-Mir-92 Hme-Mir-92-P3 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 Tca-Mir-92-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Branchiostoma | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (BraLan2) |
Sc0000007: 2890028-2890081 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-o3) |
Mir-92-o3
Sc0000007: 2890028-2890081 [+]
Ensembl
Mir-92-o4 Sc0000007: 2890480-2890541 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UGGAAUGUAGCGGUUUUGUUUUUGGCGGGAAGGUCGGGAUAAGGAACAAUGUUUCCCGCCGAUAUUGCACUUGUCCCGGCUUGCCUGCUGCCGCCAUCUUGCUCCAUCGGACCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UGGAAUGUAGCGGUUUUGUUUUU--| A GAA UCC GGCGGG AGGUCGGGAUAAG CAAUGUU \ UCGUCC UUCGGCCCUGUUC GUUAUAG C UCCAGGCUACCUCGUUCUACCGCCG^ G AC- CCG 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Bla-Mir-92-o3_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGUCGGGAUAAGGAACAAUGUU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Bla-Mir-92-o3_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
32- UAUUGCACUUGUCCCGGCUUGC -54
Get sequence
|






