| MirGeneDB ID | Bla-Mir-92-o4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | European lancelet (Branchiostoma lanceolatum) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Bla-Mir-92-o1 Bla-Mir-92-o2 Bla-Mir-92-o3 Bla-Mir-92-o5 Bla-Mir-92-o6 Bla-Mir-92-o7 Bla-Mir-92-o8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-92-P4 Aga-Mir-92-P4 Asu-Mir-92 Bfl-Mir-92-o4 Bge-Mir-92-P4 Cel-Mir-92 Dan-Mir-92-P4 Dlo-Mir-92-P4 Dma-Mir-92-P4 Dme-Mir-92-P4 Dmo-Mir-92-P4 Dpu-Mir-92-P4 Dsi-Mir-92-P4 Dya-Mir-92-P4 Esc-Mir-92 Gpa-Mir-92-P4 Gsp-Mir-92 Hme-Mir-92-P4 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 Tca-Mir-92-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Branchiostoma | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (BraLan2) |
Sc0000007: 2890480-2890541 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-o4) |
Mir-92-o3
Sc0000007: 2890028-2890081 [+]
Ensembl
Mir-92-o4 Sc0000007: 2890480-2890541 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CAGGUGACUGAAGACACGGCGUCUUUGCUCAGGUCUGGACAGUUGCAAUCUUCGUUCUGUCUCAGCCGAACAUUGCACUCGUCCCGGCCUGAGAAAUCCCGCCAAUUUUCAACGCAACUGCCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CAGGUGACUGAAGACAC-- UCUUUG U -| U C CGUUCUG GGCG CUCAGGUC GGAC AGU GCAAU UU U CCGC GAGUCCGG CCUG UCA CGUUA AA C CCGUCAACGCAACUUUUAA CCUAAA C C^ - C GCCGACU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Bla-Mir-92-o4_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGUCUGGACAGUUGCAAUCUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Bla-Mir-92-o4_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- CAUUGCACUCGUCCCGGCCUGA -62
Get sequence
|






