| MirGeneDB ID | Cpi-Mir-17-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-17 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Western painted turtle (Chrysemys picta bellii) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cpi-mir-18a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cpi-Mir-17-P1a Cpi-Mir-17-P1c Cpi-Mir-17-P1d Cpi-Mir-17-P2c Cpi-Mir-17-P4a Cpi-Mir-17-P4c Cpi-Mir-17-P4d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-17-P2a Ami-Mir-17-P2a Bta-Mir-17-P2a Cfa-Mir-17-P2a Cja-Mir-17-P2a Cli-Mir-17-P2a Cmi-Mir-17-P2a Cpo-Mir-17-P2a Dno-Mir-17-P2a Dre-Mir-17-P2a1 Dre-Mir-17-P2a2 Eca-Mir-17-P2a Ete-Mir-17-P2a Gga-Mir-17-P2a Gja-Mir-17-P2a Gmo-Mir-17-P2a1 Gmo-Mir-17-P2a2 Hsa-Mir-17-P2a Laf-Mir-17-P2a Lch-Mir-17-P2a Loc-Mir-17-P2a Mal-Mir-17-P2a2a Mal-Mir-17-P2a2b Mdo-Mir-17-P2a Mml-Mir-17-P2a Mmr-Mir-17-P2a Mmu-Mir-17-P2a Mun-Mir-17-P2a Neu-Mir-17-P2a Oan-Mir-17-P2a Ocu-Mir-17-P2a Pab-Mir-17-P2a Pbv-Mir-17-P2a Rno-Mir-17-P2a Sha-Mir-17-P2a Spt-Mir-17-P2a Sto-Mir-17-P2a Tgu-Mir-17-P2a Tni-Mir-17-P2a1 Tni-Mir-17-P2a2 Xla-Mir-17-P2a3 Xla-Mir-17-P2a4 Xtr-Mir-17-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (chrPic1) |
JH584859: 1459801-1459865 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-17-P2a) |
Mir-92-P1a
JH584859: 1459222-1459280 [-]
UCSC
Ensembl
Mir-19-P2a JH584859: 1459336-1459396 [-] UCSC Ensembl Mir-17-P4a JH584859: 1459480-1459538 [-] UCSC Ensembl Mir-19-P1a JH584859: 1459662-1459719 [-] UCSC Ensembl Mir-17-P2a JH584859: 1459801-1459865 [-] UCSC Ensembl Mir-17-P1a JH584859: 1459949-1460008 [-] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAGGUGC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GUACAAUGUGGUAUUAAGUGCUUUUUGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGCUCCUUCUGGCAUAAGAAGUUAUAUCUUCAUCCAGUCACUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GUACAAUGUGGUAUUAAGU-- U --| U UC U A UGAAGUA GCUUUUUGU CUA AGG GCA UAG GCAG UAG G UGAAGAAUA GGU UCC CGU AUC CGUC AUC A CUCACUGACCUACUUCUAUAU C CU^ U GA C - UACGAUU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cpi-Mir-17-P2a_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0037638 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UAAGGUGCAUCUAGUGCAGAUAG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cpi-Mir-17-P2a_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0037639 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
41- ACUGCCCUAAGUGCUCCUUCUGGC -65
Get sequence
|






